Mutagenetix > Incidental Mutations

Incidental Mutation 'R0734:Ric1'

68192

Institutional Source

Beutler Lab

Gene Symbol

Ric1

Ensembl Gene

ENSMUSG00000038658

Gene Name

RAB6A GEF complex partner 1

Synonyms

C030046E11Rik, C130057E09Rik

MMRRC Submission

038915-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.621) question?

Stock #

R0734 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

29522282-29606829 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 29594818 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 671 (I671K)

Ref Sequence

ENSEMBL: ENSMUSP00000043437 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043610]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043610
AA Change: I671K

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000043437
Gene: ENSMUSG00000038658
AA Change: I671K

Domain	Start	End	E-Value	Type
Blast:WD40	242	278	5e-7	BLAST
SCOP:d1gxra_	254	379	2e-4	SMART
Blast:WD40	285	334	3e-6	BLAST
Blast:WD40	482	520	5e-6	BLAST
low complexity region	642	653	N/A	INTRINSIC
Pfam:RIC1	732	991	1.9e-86	PFAM
low complexity region	1120	1132	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160452

SMART Domains

Protein: ENSMUSP00000125299
Gene: ENSMUSG00000038658

Domain	Start	End	E-Value	Type
Pfam:RIC1	8	163	1.4e-60	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000161330

SMART Domains

Protein: ENSMUSP00000125709
Gene: ENSMUSG00000038658

Domain	Start	End	E-Value	Type
low complexity region	7	28	N/A	INTRINSIC
low complexity region	142	154	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161536

Predicted Effect

unknown
Transcript: ENSMUST00000162492
AA Change: I562K

SMART Domains

Protein: ENSMUSP00000124727
Gene: ENSMUSG00000038658
AA Change: I562K

Domain	Start	End	E-Value	Type
Blast:WD40	171	207	4e-7	BLAST
SCOP:d1gxra_	183	308	2e-4	SMART
Blast:WD40	214	263	2e-6	BLAST
low complexity region	534	545	N/A	INTRINSIC
Pfam:RIC1	624	883	1.6e-86	PFAM
low complexity region	1012	1024	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.5%
3x: 98.8%
10x: 97.0%
20x: 93.3%

Validation Efficiency

99% (80/81)

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	T	A	16: 4,850,334	S530T	probably benign	Het
Acer2	G	T	4: 86,917,559	K223N	probably benign	Het
Adam19	T	G	11: 46,127,403	C431G	probably damaging	Het
Adamts16	T	G	13: 70,738,481		probably benign	Het
Aox2	A	T	1: 58,305,341	E531V	probably benign	Het
Apaf1	A	T	10: 91,037,021	N720K	probably benign	Het
Atrnl1	T	A	19: 57,654,861	W394R	probably damaging	Het
Bcl6	T	C	16: 23,968,139	E634G	probably damaging	Het
Cfap65	T	A	1: 74,918,887	Y954F	probably damaging	Het
Cobl	A	G	11: 12,375,971	V168A	probably damaging	Het
Cped1	C	T	6: 22,085,041	P210S	probably damaging	Het
Crb1	C	T	1: 139,337,084	V199M	probably benign	Het
Cyp2j6	A	T	4: 96,523,844		probably benign	Het
Dhrs3	C	G	4: 144,927,176	S289W	probably damaging	Het
Dido1	T	G	2: 180,660,042	Q2023P	probably benign	Het
Dlg4	G	A	11: 70,042,705	G550R	probably damaging	Het
Dnah12	C	A	14: 26,800,013	H1928N	probably benign	Het
Dthd1	A	C	5: 62,839,410		probably benign	Het
Erg	C	A	16: 95,370,025	G269C	possibly damaging	Het
Erich6	G	A	3: 58,629,388		probably benign	Het
F5	G	C	1: 164,198,917	R1686P	probably damaging	Het
Fancc	T	C	13: 63,331,842	R300G	probably damaging	Het
Fcer1g	T	A	1: 171,231,179	K47*	probably null	Het
Flt4	A	G	11: 49,626,717	T289A	possibly damaging	Het
Gcnt2	T	A	13: 40,860,521	F56Y	probably benign	Het
Gpatch8	G	T	11: 102,481,400	S437R	unknown	Het
Grin2a	T	A	16: 9,579,611	I871F	possibly damaging	Het
Hsd17b4	T	C	18: 50,170,777	V439A	possibly damaging	Het
Hykk	A	T	9: 54,946,432	K346M	possibly damaging	Het
Ifi208	T	C	1: 173,683,335	L352S	probably damaging	Het
Ikzf1	T	C	11: 11,758,195	V110A	probably damaging	Het
Irak3	A	T	10: 120,145,637		probably benign	Het
Lamp5	T	A	2: 136,059,030	V50E	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lrch3	C	T	16: 32,997,483	R570*	probably null	Het
Map1lc3a	T	C	2: 155,276,976	V20A	possibly damaging	Het
Map3k14	C	A	11: 103,227,000	K655N	probably benign	Het
Mark2	A	G	19: 7,285,981		probably benign	Het
Mbtd1	G	A	11: 93,923,146	G205D	probably damaging	Het
Med13	T	C	11: 86,301,237	T861A	probably benign	Het
Meltf	T	A	16: 31,881,958	Y99N	probably damaging	Het
Mex3d	G	A	10: 80,381,532	T617I	possibly damaging	Het
Muc13	G	A	16: 33,803,082	V249I	probably damaging	Het
Myo18a	C	A	11: 77,847,404	P1688Q	probably damaging	Het
Naaladl1	A	T	19: 6,112,874		probably null	Het
Ncoa3	T	A	2: 166,069,191		probably benign	Het
Nf2	T	C	11: 4,820,409	T67A	probably benign	Het
Nin	A	G	12: 70,030,113	V1056A	probably benign	Het
Olfr1426	T	A	19: 12,088,119	R224S	probably benign	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr59	A	T	11: 74,288,946	Q100L	probably damaging	Het
P3h1	T	C	4: 119,238,688	L331P	probably damaging	Het
Pabpc4l	T	C	3: 46,446,973	K79E	possibly damaging	Het
Pam	T	A	1: 97,864,362	R445*	probably null	Het
Pcdhb6	T	C	18: 37,335,334	I436T	probably damaging	Het
Piezo2	A	G	18: 63,041,723	Y1987H	probably damaging	Het
Plch2	G	A	4: 154,996,283	T477I	probably damaging	Het
Postn	G	A	3: 54,362,715	G72R	probably damaging	Het
Proca1	G	A	11: 78,201,802		probably benign	Het
Psip1	T	A	4: 83,463,588		probably benign	Het
Ptprd	G	A	4: 76,140,597	P153L	probably damaging	Het
Rgl1	T	C	1: 152,554,300	D242G	probably damaging	Het
Rxrg	T	A	1: 167,627,444	C199S	probably damaging	Het
Sec24c	A	C	14: 20,693,745	D1006A	probably damaging	Het
Sec63	A	G	10: 42,796,208	T173A	probably benign	Het
Sfxn5	T	C	6: 85,267,865		probably benign	Het
Spam1	A	G	6: 24,796,949	I300V	probably benign	Het
Spem1	A	G	11: 69,821,271	L189P	probably damaging	Het
Sptbn2	A	T	19: 4,748,123	R1959*	probably null	Het
Timeless	C	T	10: 128,250,060	R935W	probably damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Trim24	T	C	6: 37,919,465	Y286H	possibly damaging	Het
Ttyh2	A	G	11: 114,710,193		probably benign	Het
Zbtb21	C	T	16: 97,952,627	C180Y	probably damaging	Het
Zfp746	T	C	6: 48,064,899	T298A	probably damaging	Het

Other mutations in Ric1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00574:Ric1	APN	19	29595362	missense	probably damaging	1.00
IGL00902:Ric1	APN	19	29567231	missense	probably benign	0.05
IGL01405:Ric1	APN	19	29567370	splice site	probably benign
IGL01629:Ric1	APN	19	29603981	missense	probably benign	0.02
IGL01688:Ric1	APN	19	29577614	missense	probably benign	0.00
IGL01966:Ric1	APN	19	29595563	missense	probably benign	0.33
IGL02123:Ric1	APN	19	29594800	missense	probably benign
IGL02590:Ric1	APN	19	29567481	splice site	probably benign
IGL02655:Ric1	APN	19	29595451	missense	probably damaging	1.00
IGL02699:Ric1	APN	19	29522557	missense	possibly damaging	0.51
IGL02718:Ric1	APN	19	29533240	missense	probably damaging	1.00
IGL03026:Ric1	APN	19	29599833	missense	probably benign	0.02
IGL03142:Ric1	APN	19	29600980	missense	possibly damaging	0.89
R0109:Ric1	UTSW	19	29586677	synonymous	silent
R0336:Ric1	UTSW	19	29587793	missense	probably damaging	0.96
R0362:Ric1	UTSW	19	29601011	critical splice donor site	probably null
R0676:Ric1	UTSW	19	29577647	missense	probably benign
R1004:Ric1	UTSW	19	29602357	missense	probably benign	0.00
R1148:Ric1	UTSW	19	29579849	missense	probably benign
R1148:Ric1	UTSW	19	29579849	missense	probably benign
R1216:Ric1	UTSW	19	29577735	missense	probably benign	0.00
R1493:Ric1	UTSW	19	29579849	missense	probably benign
R1848:Ric1	UTSW	19	29600813	splice site	probably null
R1872:Ric1	UTSW	19	29602668	missense	probably benign	0.32
R1942:Ric1	UTSW	19	29601016	splice site	probably benign
R2143:Ric1	UTSW	19	29533252	missense	probably damaging	1.00
R2143:Ric1	UTSW	19	29533253	missense	probably damaging	0.96
R2679:Ric1	UTSW	19	29604030	missense	probably benign
R2878:Ric1	UTSW	19	29602330	missense	possibly damaging	0.77
R2970:Ric1	UTSW	19	29577718	missense	probably benign	0.15
R3420:Ric1	UTSW	19	29567590	missense	probably damaging	0.96
R3421:Ric1	UTSW	19	29567590	missense	probably damaging	0.96
R3940:Ric1	UTSW	19	29570762	missense	probably damaging	1.00
R4004:Ric1	UTSW	19	29579801	missense	probably benign	0.44
R4225:Ric1	UTSW	19	29602731	missense	possibly damaging	0.89
R4280:Ric1	UTSW	19	29586550	missense	probably damaging	1.00
R4283:Ric1	UTSW	19	29586550	missense	probably damaging	1.00
R4516:Ric1	UTSW	19	29570765	missense	probably benign	0.17
R4702:Ric1	UTSW	19	29598017	missense	possibly damaging	0.85
R4824:Ric1	UTSW	19	29585842	missense	probably damaging	1.00
R4835:Ric1	UTSW	19	29595536	missense	possibly damaging	0.80
R5860:Ric1	UTSW	19	29599845	missense	possibly damaging	0.91
R5883:Ric1	UTSW	19	29595989	missense	probably damaging	1.00
R5965:Ric1	UTSW	19	29570771	missense	probably damaging	0.99
R6141:Ric1	UTSW	19	29595442	missense	probably damaging	1.00
R6236:Ric1	UTSW	19	29595426	missense	possibly damaging	0.91
R6271:Ric1	UTSW	19	29567365	splice site	probably null
R6345:Ric1	UTSW	19	29604085	missense	probably benign	0.09
R6371:Ric1	UTSW	19	29562026	missense	probably benign	0.35
R6547:Ric1	UTSW	19	29594826	missense	probably damaging	1.00
R6924:Ric1	UTSW	19	29569388	missense	probably damaging	0.98
R6969:Ric1	UTSW	19	29585782	missense	probably damaging	1.00
R6970:Ric1	UTSW	19	29587772	missense	probably damaging	1.00
R6993:Ric1	UTSW	19	29586613	missense	probably damaging	1.00
R7296:Ric1	UTSW	19	29584578	critical splice donor site	probably null
R7434:Ric1	UTSW	19	29574780	missense	probably damaging	1.00
R7619:Ric1	UTSW	19	29579775	missense	probably benign	0.32
R7850:Ric1	UTSW	19	29594893	missense	probably benign
R7941:Ric1	UTSW	19	29533259	missense	probably damaging	1.00
R8115:Ric1	UTSW	19	29586573	missense	probably damaging	1.00
R8117:Ric1	UTSW	19	29574791	missense	probably benign	0.08
R8477:Ric1	UTSW	19	29597783	missense	probably damaging	1.00
X0064:Ric1	UTSW	19	29587802	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTTGTTTTCCCACAGAGCCTAGC -3'
(R):5'- GGTAGTCCAGACATTTTCCACCGAC -3'

Sequencing Primer
(F):5'- CCTAGCAAAATGGCTGTGC -3'
(R):5'- GTTCTTGGTGCCTAAGTCACAAC -3'

Posted On

2013-09-03