Incidental Mutation 'R8955:Flnb'
ID 681957
Institutional Source Beutler Lab
Gene Symbol Flnb
Ensembl Gene ENSMUSG00000025278
Gene Name filamin, beta
Synonyms
MMRRC Submission 068791-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8955 (G1)
Quality Score 219.009
Status Not validated
Chromosome 14
Chromosomal Location 14518185-14651816 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 7892874 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 648 (V648G)
Ref Sequence ENSEMBL: ENSMUSP00000052020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052678]
AlphaFold Q80X90
Predicted Effect probably damaging
Transcript: ENSMUST00000052678
AA Change: V648G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052020
Gene: ENSMUSG00000025278
AA Change: V648G

DomainStartEndE-ValueType
CH 18 120 2.38e-26 SMART
CH 141 237 1.83e-18 SMART
IG_FLMN 253 350 1.17e-33 SMART
IG_FLMN 353 449 2.08e-34 SMART
IG_FLMN 451 546 3.42e-35 SMART
IG_FLMN 548 639 6.06e-27 SMART
IG_FLMN 644 739 1.94e-34 SMART
IG_FLMN 741 842 4.25e-31 SMART
IG_FLMN 844 941 5.16e-30 SMART
IG_FLMN 943 1037 5.12e-25 SMART
IG_FLMN 1039 1130 5.31e-41 SMART
IG_FLMN 1132 1225 1.4e-31 SMART
IG_FLMN 1227 1325 1.42e-32 SMART
IG_FLMN 1327 1418 5.19e-35 SMART
IG_FLMN 1420 1514 2.48e-41 SMART
IG_FLMN 1516 1611 3.15e-34 SMART
IG_FLMN 1613 1707 4.99e-37 SMART
IG_FLMN 1730 1819 4.44e-11 SMART
IG_FLMN 1820 1911 5.82e-38 SMART
IG_FLMN 1914 1997 5.68e-9 SMART
IG_FLMN 2001 2092 4.45e-34 SMART
IG_FLMN 2101 2188 1.24e-9 SMART
IG_FLMN 2192 2283 4.48e-39 SMART
IG_FLMN 2286 2378 2.94e-25 SMART
IG_FLMN 2383 2474 5.66e-27 SMART
IG_FLMN 2511 2602 1.63e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the filamin family. The encoded protein interacts with glycoprotein Ib alpha as part of the process to repair vascular injuries. The platelet glycoprotein Ib complex includes glycoprotein Ib alpha, and it binds the actin cytoskeleton. Mutations in this gene have been found in several conditions: atelosteogenesis type 1 and type 3; boomerang dysplasia; autosomal dominant Larsen syndrome; and spondylocarpotarsal synostosis syndrome. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mutations in this gene cause skeletal defects including runting, premature mineralization, and bone fusion. Nullizygous mice show a delay and reduction in long bone growth. Truncation mutations cause early fusion of spinal vertebrae due to enhanced chondrocyte hypertrophy and early differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 C T 15: 64,576,554 (GRCm39) V1003I possibly damaging Het
Adgra3 T A 5: 50,118,731 (GRCm39) Y939F probably benign Het
Adra2b T C 2: 127,205,504 (GRCm39) V2A probably benign Het
Aga T A 8: 53,974,164 (GRCm39) Y296N possibly damaging Het
Apc A G 18: 34,401,370 (GRCm39) Q52R probably damaging Het
Arfgef1 A T 1: 10,270,062 (GRCm39) S362R probably benign Het
Arhgef7 C T 8: 11,808,451 (GRCm39) probably benign Het
Bmp5 A T 9: 75,805,835 (GRCm39) M446L probably damaging Het
Carmil3 C T 14: 55,733,534 (GRCm39) T350I probably damaging Het
Cd44 T A 2: 102,683,363 (GRCm39) T224S probably damaging Het
Cep112 A T 11: 108,643,260 (GRCm39) I7F possibly damaging Het
Chrna2 G A 14: 66,379,681 (GRCm39) A7T probably benign Het
Cldn16 G A 16: 26,301,270 (GRCm39) V193I probably benign Het
Clec4a3 G A 6: 122,943,479 (GRCm39) E100K possibly damaging Het
Cntln C T 4: 84,986,110 (GRCm39) T1026I possibly damaging Het
Cyp4v3 T A 8: 45,761,564 (GRCm39) I420F probably benign Het
Dcbld2 G A 16: 58,271,125 (GRCm39) A301T Het
Dnah1 A T 14: 31,007,950 (GRCm39) D2152E probably benign Het
Dpy19l4 A G 4: 11,290,195 (GRCm39) V179A probably benign Het
Dusp4 T A 8: 35,284,462 (GRCm39) I259N probably damaging Het
Enpp1 T A 10: 24,544,926 (GRCm39) I318F probably benign Het
Entpd6 T C 2: 150,595,005 (GRCm39) V15A possibly damaging Het
Epb41l1 C G 2: 156,363,923 (GRCm39) Q811E probably benign Het
Epb41l5 T C 1: 119,570,292 (GRCm39) H32R probably damaging Het
Fam135b C T 15: 71,334,063 (GRCm39) V1044I possibly damaging Het
Fat4 A T 3: 39,037,778 (GRCm39) H3810L probably benign Het
Fbxw28 T A 9: 109,167,857 (GRCm39) probably null Het
Fndc3a T C 14: 72,794,410 (GRCm39) T787A probably benign Het
Gli2 T A 1: 118,783,187 (GRCm39) H106L probably damaging Het
Gm10283 T A 8: 60,954,390 (GRCm39) probably null Het
Gm3336 C T 8: 71,174,545 (GRCm39) R67* probably null Het
Gsr T G 8: 34,183,936 (GRCm39) I399M possibly damaging Het
Gtf2ird2 T A 5: 134,245,596 (GRCm39) M618K probably damaging Het
Gtf3c3 T A 1: 54,462,722 (GRCm39) D347V probably benign Het
Hspa12a T C 19: 58,788,058 (GRCm39) Y588C probably damaging Het
Il20ra A G 10: 19,635,160 (GRCm39) E467G possibly damaging Het
Inf2 A G 12: 112,576,998 (GRCm39) I991V unknown Het
Irag2 A T 6: 145,117,390 (GRCm39) M376L probably benign Het
Irx6 T C 8: 93,405,040 (GRCm39) C303R probably damaging Het
Kcnmb4 T A 10: 116,309,381 (GRCm39) K16* probably null Het
Kirrel3 T C 9: 34,855,738 (GRCm39) L86P probably damaging Het
Lipo5 A C 19: 33,450,530 (GRCm39) F21V Het
Lrrc31 T A 3: 30,733,267 (GRCm39) R482S probably benign Het
Lrrc3b C T 14: 15,358,159 (GRCm38) C149Y probably damaging Het
Lrrk1 A G 7: 65,919,573 (GRCm39) M446T probably benign Het
Macroh2a2 A T 10: 61,593,610 (GRCm39) I22N probably damaging Het
Mettl14 C T 3: 123,167,693 (GRCm39) D222N probably benign Het
Mfsd4b3-ps G A 10: 39,824,072 (GRCm39) H63Y probably benign Het
Myo16 T C 8: 10,426,175 (GRCm39) W311R probably damaging Het
Nccrp1 A T 7: 28,245,628 (GRCm39) N151K probably benign Het
Obsl1 T C 1: 75,480,493 (GRCm39) D377G probably damaging Het
Or5b97 T A 19: 12,878,578 (GRCm39) T189S probably benign Het
Or5p80 T A 7: 108,229,506 (GRCm39) C102* probably null Het
Or7c19 T A 8: 85,957,913 (GRCm39) I263N probably benign Het
Or7c70 G T 10: 78,683,576 (GRCm39) P58T probably damaging Het
Pigb T C 9: 72,945,983 (GRCm39) N63S probably damaging Het
Plch2 T C 4: 155,077,023 (GRCm39) E577G probably benign Het
Prkab2 T C 3: 97,573,943 (GRCm39) V194A probably benign Het
Psd3 T C 8: 68,416,461 (GRCm39) I479V probably benign Het
Ralgapb C A 2: 158,279,264 (GRCm39) P117T probably benign Het
Ralgapb C G 2: 158,337,389 (GRCm39) T1116R probably damaging Het
Rpap2 T A 5: 107,768,361 (GRCm39) S400T possibly damaging Het
Rpgrip1l C A 8: 92,007,456 (GRCm39) W378L possibly damaging Het
Rps20 T A 4: 3,834,617 (GRCm39) M82L probably benign Het
Rps5 T C 7: 12,659,440 (GRCm39) M77T possibly damaging Het
Scaf11 A G 15: 96,318,371 (GRCm39) S398P probably damaging Het
Sdf2 T A 11: 78,145,763 (GRCm39) D153E probably benign Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,957,756 (GRCm39) probably benign Het
Slc12a9 T C 5: 137,329,270 (GRCm39) N128S probably damaging Het
Slc25a32 C A 15: 38,960,946 (GRCm39) G246C probably damaging Het
Slc38a4 C T 15: 96,914,662 (GRCm39) A64T probably benign Het
Slit3 T C 11: 35,589,207 (GRCm39) V1254A probably damaging Het
Slx4 T C 16: 3,808,111 (GRCm39) K481R probably benign Het
Tcea1 A G 1: 4,959,732 (GRCm39) T136A probably benign Het
Thra A G 11: 98,644,449 (GRCm39) D13G possibly damaging Het
Tmed9 G A 13: 55,744,775 (GRCm39) S227N probably benign Het
Trim80 C A 11: 115,331,538 (GRCm39) T20K probably benign Het
Trmt61a G T 12: 111,649,256 (GRCm39) V276L probably benign Het
Trpc4ap T C 2: 155,508,171 (GRCm39) D160G possibly damaging Het
Ubr5 C T 15: 38,029,825 (GRCm39) E467K Het
Vars2 C A 17: 35,972,541 (GRCm39) G26W probably damaging Het
Vmn1r226 G T 17: 20,908,287 (GRCm39) R173L possibly damaging Het
Vmn1r29 G T 6: 58,284,284 (GRCm39) M1I probably null Het
Vmn2r3 G T 3: 64,168,803 (GRCm39) P578Q possibly damaging Het
Vmn2r57 A T 7: 41,049,571 (GRCm39) I726N possibly damaging Het
Zfp39 A T 11: 58,780,946 (GRCm39) Y605* probably null Het
Other mutations in Flnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Flnb APN 14 7,917,390 (GRCm38) splice site probably benign
IGL01063:Flnb APN 14 7,926,518 (GRCm38) splice site probably benign
IGL01135:Flnb APN 14 7,909,736 (GRCm38) missense probably benign
IGL01139:Flnb APN 14 7,945,989 (GRCm38) missense probably damaging 1.00
IGL01364:Flnb APN 14 7,934,562 (GRCm38) critical splice acceptor site probably null
IGL01417:Flnb APN 14 7,905,513 (GRCm38) missense probably damaging 0.99
IGL01505:Flnb APN 14 7,902,003 (GRCm38) critical splice donor site probably null
IGL01560:Flnb APN 14 7,893,829 (GRCm38) missense probably benign 0.07
IGL01621:Flnb APN 14 7,950,470 (GRCm38) missense probably damaging 1.00
IGL01656:Flnb APN 14 7,902,010 (GRCm38) splice site probably benign
IGL01889:Flnb APN 14 7,935,967 (GRCm38) missense possibly damaging 0.85
IGL01987:Flnb APN 14 7,922,748 (GRCm38) critical splice donor site probably null
IGL02322:Flnb APN 14 7,894,676 (GRCm38) missense probably damaging 1.00
IGL02496:Flnb APN 14 7,930,919 (GRCm38) splice site probably benign
IGL02752:Flnb APN 14 7,917,338 (GRCm38) missense probably benign
IGL03001:Flnb APN 14 7,934,680 (GRCm38) missense probably damaging 0.99
IGL03076:Flnb APN 14 7,901,988 (GRCm38) missense probably benign 0.01
IGL03085:Flnb APN 14 7,882,211 (GRCm38) missense probably benign
IGL03170:Flnb APN 14 7,818,261 (GRCm38) missense possibly damaging 0.90
IGL03373:Flnb APN 14 7,890,867 (GRCm38) critical splice donor site probably null
Boomerang UTSW 14 7,901,945 (GRCm38) missense probably damaging 1.00
Queensland UTSW 14 7,927,352 (GRCm38) missense probably damaging 1.00
R3437_Flnb_252 UTSW 14 7,942,057 (GRCm38) missense probably damaging 0.97
R8441_Flnb_221 UTSW 14 7,896,488 (GRCm38) missense probably benign 0.15
Rhodelinda UTSW 14 7,887,682 (GRCm38) splice site probably benign
saul UTSW 14 7,889,183 (GRCm38) missense probably damaging 0.99
Xerxes UTSW 14 7,867,551 (GRCm38) missense probably damaging 1.00
R0068:Flnb UTSW 14 7,915,290 (GRCm38) missense possibly damaging 0.49
R0068:Flnb UTSW 14 7,915,290 (GRCm38) missense possibly damaging 0.49
R0084:Flnb UTSW 14 7,935,979 (GRCm38) missense probably benign
R0128:Flnb UTSW 14 7,901,951 (GRCm38) missense probably damaging 0.99
R0130:Flnb UTSW 14 7,901,951 (GRCm38) missense probably damaging 0.99
R0148:Flnb UTSW 14 7,939,077 (GRCm38) missense probably benign 0.01
R0166:Flnb UTSW 14 7,896,115 (GRCm38) missense probably damaging 1.00
R0376:Flnb UTSW 14 7,946,014 (GRCm38) critical splice donor site probably null
R0547:Flnb UTSW 14 7,912,943 (GRCm38) splice site probably null
R0612:Flnb UTSW 14 7,887,682 (GRCm38) splice site probably benign
R0656:Flnb UTSW 14 7,927,352 (GRCm38) missense probably damaging 1.00
R0691:Flnb UTSW 14 7,890,810 (GRCm38) missense probably benign 0.16
R1241:Flnb UTSW 14 7,896,503 (GRCm38) missense probably benign 0.06
R1572:Flnb UTSW 14 7,883,908 (GRCm38) missense probably damaging 0.97
R1682:Flnb UTSW 14 7,913,121 (GRCm38) missense probably benign 0.04
R1807:Flnb UTSW 14 7,934,645 (GRCm38) missense probably benign 0.26
R1848:Flnb UTSW 14 7,892,113 (GRCm38) missense probably damaging 1.00
R1959:Flnb UTSW 14 7,884,735 (GRCm38) nonsense probably null
R2078:Flnb UTSW 14 7,927,466 (GRCm38) missense probably damaging 1.00
R2132:Flnb UTSW 14 7,873,376 (GRCm38) missense probably benign 0.04
R2209:Flnb UTSW 14 7,905,507 (GRCm38) nonsense probably null
R2212:Flnb UTSW 14 7,881,652 (GRCm38) small deletion probably benign
R2213:Flnb UTSW 14 7,881,652 (GRCm38) small deletion probably benign
R2363:Flnb UTSW 14 7,945,950 (GRCm38) missense possibly damaging 0.95
R2415:Flnb UTSW 14 7,929,932 (GRCm38) missense probably benign 0.07
R2983:Flnb UTSW 14 7,882,250 (GRCm38) missense probably damaging 1.00
R3001:Flnb UTSW 14 7,907,162 (GRCm38) missense probably benign 0.22
R3002:Flnb UTSW 14 7,907,162 (GRCm38) missense probably benign 0.22
R3436:Flnb UTSW 14 7,942,057 (GRCm38) missense probably damaging 0.97
R3437:Flnb UTSW 14 7,942,057 (GRCm38) missense probably damaging 0.97
R3778:Flnb UTSW 14 7,915,353 (GRCm38) missense probably benign 0.06
R3783:Flnb UTSW 14 7,889,236 (GRCm38) missense probably benign 0.04
R4162:Flnb UTSW 14 7,915,374 (GRCm38) missense possibly damaging 0.81
R4163:Flnb UTSW 14 7,915,374 (GRCm38) missense possibly damaging 0.81
R4164:Flnb UTSW 14 7,915,374 (GRCm38) missense possibly damaging 0.81
R4356:Flnb UTSW 14 7,922,700 (GRCm38) missense probably benign
R4369:Flnb UTSW 14 7,942,216 (GRCm38) missense probably benign
R4783:Flnb UTSW 14 7,905,701 (GRCm38) missense probably benign 0.12
R4785:Flnb UTSW 14 7,905,701 (GRCm38) missense probably benign 0.12
R4790:Flnb UTSW 14 7,905,661 (GRCm38) missense probably benign 0.34
R4828:Flnb UTSW 14 7,919,238 (GRCm38) missense probably benign 0.13
R4882:Flnb UTSW 14 7,929,936 (GRCm38) missense possibly damaging 0.56
R5002:Flnb UTSW 14 7,945,882 (GRCm38) missense probably damaging 1.00
R5058:Flnb UTSW 14 7,924,262 (GRCm38) nonsense probably null
R5184:Flnb UTSW 14 7,901,945 (GRCm38) missense probably damaging 1.00
R5186:Flnb UTSW 14 7,909,748 (GRCm38) missense probably damaging 1.00
R5395:Flnb UTSW 14 7,883,881 (GRCm38) missense probably benign 0.02
R5421:Flnb UTSW 14 7,926,494 (GRCm38) missense probably damaging 1.00
R5667:Flnb UTSW 14 7,890,843 (GRCm38) missense probably benign 0.00
R5671:Flnb UTSW 14 7,890,843 (GRCm38) missense probably benign 0.00
R5714:Flnb UTSW 14 7,929,073 (GRCm38) missense probably damaging 1.00
R5860:Flnb UTSW 14 7,931,135 (GRCm38) missense probably damaging 1.00
R5892:Flnb UTSW 14 7,907,183 (GRCm38) missense probably damaging 1.00
R5924:Flnb UTSW 14 7,890,765 (GRCm38) missense probably benign 0.00
R6131:Flnb UTSW 14 7,894,635 (GRCm38) missense possibly damaging 0.79
R6244:Flnb UTSW 14 7,892,092 (GRCm38) missense probably damaging 1.00
R6489:Flnb UTSW 14 7,867,551 (GRCm38) missense probably damaging 1.00
R6582:Flnb UTSW 14 7,892,275 (GRCm38) critical splice donor site probably null
R6586:Flnb UTSW 14 7,929,138 (GRCm38) missense possibly damaging 0.93
R6611:Flnb UTSW 14 7,915,318 (GRCm38) missense probably damaging 1.00
R6626:Flnb UTSW 14 7,929,012 (GRCm38) missense probably damaging 1.00
R6700:Flnb UTSW 14 7,892,189 (GRCm38) missense probably damaging 0.99
R6738:Flnb UTSW 14 7,904,536 (GRCm38) missense probably benign 0.01
R6864:Flnb UTSW 14 7,905,640 (GRCm38) missense possibly damaging 0.84
R6916:Flnb UTSW 14 7,907,171 (GRCm38) missense probably damaging 0.99
R7117:Flnb UTSW 14 7,894,214 (GRCm38) missense probably benign 0.02
R7164:Flnb UTSW 14 7,915,944 (GRCm38) splice site probably null
R7328:Flnb UTSW 14 7,894,660 (GRCm38) nonsense probably null
R7328:Flnb UTSW 14 7,883,788 (GRCm38) missense possibly damaging 0.95
R7687:Flnb UTSW 14 7,924,224 (GRCm38) missense probably damaging 1.00
R7716:Flnb UTSW 14 7,917,274 (GRCm38) missense possibly damaging 0.64
R7763:Flnb UTSW 14 7,926,478 (GRCm38) missense probably benign 0.00
R7821:Flnb UTSW 14 7,939,113 (GRCm38) missense probably benign 0.00
R7921:Flnb UTSW 14 7,933,800 (GRCm38) missense possibly damaging 0.57
R8008:Flnb UTSW 14 7,892,155 (GRCm38) missense probably damaging 1.00
R8075:Flnb UTSW 14 7,913,048 (GRCm38) missense probably benign 0.00
R8084:Flnb UTSW 14 7,907,243 (GRCm38) missense probably benign 0.00
R8259:Flnb UTSW 14 7,889,183 (GRCm38) missense probably damaging 0.99
R8441:Flnb UTSW 14 7,896,488 (GRCm38) missense probably benign 0.15
R8493:Flnb UTSW 14 7,869,822 (GRCm38) missense probably damaging 0.97
R8508:Flnb UTSW 14 7,950,394 (GRCm38) missense probably damaging 0.98
R8531:Flnb UTSW 14 7,929,939 (GRCm38) missense probably damaging 1.00
R8812:Flnb UTSW 14 7,887,624 (GRCm38) missense probably benign 0.06
R8814:Flnb UTSW 14 7,927,409 (GRCm38) missense probably damaging 1.00
R8825:Flnb UTSW 14 7,887,566 (GRCm38) missense probably damaging 1.00
R8868:Flnb UTSW 14 7,908,671 (GRCm38) missense probably benign 0.02
R8955:Flnb UTSW 14 7,904,688 (GRCm38) nonsense probably null
R8976:Flnb UTSW 14 7,901,882 (GRCm38) critical splice acceptor site probably null
R9055:Flnb UTSW 14 7,908,553 (GRCm38) missense probably benign 0.00
R9148:Flnb UTSW 14 7,817,996 (GRCm38) start gained probably benign
R9179:Flnb UTSW 14 7,887,541 (GRCm38) nonsense probably null
R9180:Flnb UTSW 14 7,818,219 (GRCm38) missense probably damaging 1.00
R9189:Flnb UTSW 14 7,892,976 (GRCm38) missense possibly damaging 0.90
R9286:Flnb UTSW 14 7,873,414 (GRCm38) missense probably damaging 0.98
R9288:Flnb UTSW 14 7,904,498 (GRCm38) missense probably benign 0.43
R9354:Flnb UTSW 14 7,818,411 (GRCm38) missense probably benign 0.13
R9484:Flnb UTSW 14 7,929,004 (GRCm38) missense probably benign 0.06
R9505:Flnb UTSW 14 7,904,665 (GRCm38) missense probably benign
R9525:Flnb UTSW 14 7,905,481 (GRCm38) missense probably damaging 1.00
R9621:Flnb UTSW 14 7,926,421 (GRCm38) missense probably damaging 0.99
R9630:Flnb UTSW 14 7,926,438 (GRCm38) nonsense probably null
R9739:Flnb UTSW 14 7,935,954 (GRCm38) nonsense probably null
R9760:Flnb UTSW 14 7,929,846 (GRCm38) missense probably damaging 0.98
X0066:Flnb UTSW 14 7,908,636 (GRCm38) missense probably damaging 1.00
Z1088:Flnb UTSW 14 7,905,871 (GRCm38) missense probably benign 0.04
Z1176:Flnb UTSW 14 7,942,066 (GRCm38) missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GCTCAGAGTACAGCAGGTAG -3'
(R):5'- TCAGGACCAGATGCATGAGC -3'

Sequencing Primer
(F):5'- TGTTTTAGAGTGTTTTCTCCTTCAAG -3'
(R):5'- TGAGCAACTCCACATTACACCTCTG -3'
Posted On 2021-08-31