Incidental Mutation 'R8955:Flnb'
ID 681958
Institutional Source Beutler Lab
Gene Symbol Flnb
Ensembl Gene ENSMUSG00000025278
Gene Name filamin, beta
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8955 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 7817957-7951588 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 7904688 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 1030 (Y1030*)
Ref Sequence ENSEMBL: ENSMUSP00000052020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052678]
AlphaFold Q80X90
Predicted Effect probably null
Transcript: ENSMUST00000052678
AA Change: Y1030*
SMART Domains Protein: ENSMUSP00000052020
Gene: ENSMUSG00000025278
AA Change: Y1030*

DomainStartEndE-ValueType
CH 18 120 2.38e-26 SMART
CH 141 237 1.83e-18 SMART
IG_FLMN 253 350 1.17e-33 SMART
IG_FLMN 353 449 2.08e-34 SMART
IG_FLMN 451 546 3.42e-35 SMART
IG_FLMN 548 639 6.06e-27 SMART
IG_FLMN 644 739 1.94e-34 SMART
IG_FLMN 741 842 4.25e-31 SMART
IG_FLMN 844 941 5.16e-30 SMART
IG_FLMN 943 1037 5.12e-25 SMART
IG_FLMN 1039 1130 5.31e-41 SMART
IG_FLMN 1132 1225 1.4e-31 SMART
IG_FLMN 1227 1325 1.42e-32 SMART
IG_FLMN 1327 1418 5.19e-35 SMART
IG_FLMN 1420 1514 2.48e-41 SMART
IG_FLMN 1516 1611 3.15e-34 SMART
IG_FLMN 1613 1707 4.99e-37 SMART
IG_FLMN 1730 1819 4.44e-11 SMART
IG_FLMN 1820 1911 5.82e-38 SMART
IG_FLMN 1914 1997 5.68e-9 SMART
IG_FLMN 2001 2092 4.45e-34 SMART
IG_FLMN 2101 2188 1.24e-9 SMART
IG_FLMN 2192 2283 4.48e-39 SMART
IG_FLMN 2286 2378 2.94e-25 SMART
IG_FLMN 2383 2474 5.66e-27 SMART
IG_FLMN 2511 2602 1.63e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the filamin family. The encoded protein interacts with glycoprotein Ib alpha as part of the process to repair vascular injuries. The platelet glycoprotein Ib complex includes glycoprotein Ib alpha, and it binds the actin cytoskeleton. Mutations in this gene have been found in several conditions: atelosteogenesis type 1 and type 3; boomerang dysplasia; autosomal dominant Larsen syndrome; and spondylocarpotarsal synostosis syndrome. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mutations in this gene cause skeletal defects including runting, premature mineralization, and bone fusion. Nullizygous mice show a delay and reduction in long bone growth. Truncation mutations cause early fusion of spinal vertebrae due to enhanced chondrocyte hypertrophy and early differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 C T 15: 64,704,705 V1003I possibly damaging Het
Adgra3 T A 5: 49,961,389 Y939F probably benign Het
Adra2b T C 2: 127,363,584 V2A probably benign Het
Aga T A 8: 53,521,129 Y296N possibly damaging Het
Apc A G 18: 34,268,317 Q52R probably damaging Het
Arfgef1 A T 1: 10,199,837 S362R probably benign Het
Arhgef7 C T 8: 11,758,451 probably benign Het
Bmp5 A T 9: 75,898,553 M446L probably damaging Het
Carmil3 C T 14: 55,496,077 T350I probably damaging Het
Cd44 T A 2: 102,853,018 T224S probably damaging Het
Cep112 A T 11: 108,752,434 I7F possibly damaging Het
Chrna2 G A 14: 66,142,232 A7T probably benign Het
Cldn16 G A 16: 26,482,520 V193I probably benign Het
Clec4a3 G A 6: 122,966,520 E100K possibly damaging Het
Cntln C T 4: 85,067,873 T1026I possibly damaging Het
Cyp4v3 T A 8: 45,308,527 I420F probably benign Het
Dcbld2 G A 16: 58,450,762 A301T Het
Dnah1 A T 14: 31,285,993 D2152E probably benign Het
Dpy19l4 A G 4: 11,290,195 V179A probably benign Het
Dusp4 T A 8: 34,817,308 I259N probably damaging Het
Enpp1 T A 10: 24,669,028 I318F probably benign Het
Entpd6 T C 2: 150,753,085 V15A possibly damaging Het
Epb41l1 C G 2: 156,522,003 Q811E probably benign Het
Epb41l5 T C 1: 119,642,562 H32R probably damaging Het
Fam135b C T 15: 71,462,214 V1044I possibly damaging Het
Fat4 A T 3: 38,983,629 H3810L probably benign Het
Fbxw28 T A 9: 109,338,789 probably null Het
Fndc3a T C 14: 72,556,970 T787A probably benign Het
Gli2 T A 1: 118,855,457 H106L probably damaging Het
Gm10283 T A 8: 60,501,356 probably null Het
Gm3336 C T 8: 70,721,896 R67* probably null Het
Gsr T G 8: 33,693,908 I399M possibly damaging Het
Gtf2ird2 T A 5: 134,216,754 M618K probably damaging Het
Gtf3c3 T A 1: 54,423,563 D347V probably benign Het
H2afy2 A T 10: 61,757,831 I22N probably damaging Het
Hspa12a T C 19: 58,799,626 Y588C probably damaging Het
Il20ra A G 10: 19,759,412 E467G possibly damaging Het
Inf2 A G 12: 112,610,564 I991V unknown Het
Irx6 T C 8: 92,678,412 C303R probably damaging Het
Kcnmb4 T A 10: 116,473,476 K16* probably null Het
Kirrel3 T C 9: 34,944,442 L86P probably damaging Het
Lipo5 A C 19: 33,473,130 F21V Het
Lrmp A T 6: 145,171,664 M376L probably benign Het
Lrrc31 T A 3: 30,679,118 R482S probably benign Het
Lrrc3b C T 14: 15,358,159 C149Y probably damaging Het
Lrrk1 A G 7: 66,269,825 M446T probably benign Het
Mettl14 C T 3: 123,374,044 D222N probably benign Het
Mfsd4b3 G A 10: 39,948,076 H63Y probably benign Het
Myo16 T C 8: 10,376,175 W311R probably damaging Het
Nccrp1 A T 7: 28,546,203 N151K probably benign Het
Obsl1 T C 1: 75,503,849 D377G probably damaging Het
Olfr1356 G T 10: 78,847,742 P58T probably damaging Het
Olfr1447 T A 19: 12,901,214 T189S probably benign Het
Olfr371 T A 8: 85,231,284 I263N probably benign Het
Olfr508 T A 7: 108,630,299 C102* probably null Het
Pigb T C 9: 73,038,701 N63S probably damaging Het
Plch2 T C 4: 154,992,566 E577G probably benign Het
Prkab2 T C 3: 97,666,627 V194A probably benign Het
Psd3 T C 8: 67,963,809 I479V probably benign Het
Ralgapb C A 2: 158,437,344 P117T probably benign Het
Ralgapb C G 2: 158,495,469 T1116R probably damaging Het
Rpap2 T A 5: 107,620,495 S400T possibly damaging Het
Rpgrip1l C A 8: 91,280,828 W378L possibly damaging Het
Rps20 T A 4: 3,834,617 M82L probably benign Het
Rps5 T C 7: 12,925,513 M77T possibly damaging Het
Scaf11 A G 15: 96,420,490 S398P probably damaging Het
Sdf2 T A 11: 78,254,937 D153E probably benign Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Slc12a9 T C 5: 137,331,008 N128S probably damaging Het
Slc25a32 C A 15: 39,097,551 G246C probably damaging Het
Slc38a4 C T 15: 97,016,781 A64T probably benign Het
Slit3 T C 11: 35,698,380 V1254A probably damaging Het
Slx4 T C 16: 3,990,247 K481R probably benign Het
Tcea1 A G 1: 4,889,509 T136A probably benign Het
Thra A G 11: 98,753,623 D13G possibly damaging Het
Tmed9 G A 13: 55,596,962 S227N probably benign Het
Trim80 C A 11: 115,440,712 T20K probably benign Het
Trmt61a G T 12: 111,682,822 V276L probably benign Het
Trpc4ap T C 2: 155,666,251 D160G possibly damaging Het
Ubr5 C T 15: 38,029,581 E467K Het
Vars2 C A 17: 35,661,649 G26W probably damaging Het
Vmn1r226 G T 17: 20,688,025 R173L possibly damaging Het
Vmn1r29 G T 6: 58,307,299 M1I probably null Het
Vmn2r3 G T 3: 64,261,382 P578Q possibly damaging Het
Vmn2r57 A T 7: 41,400,147 I726N possibly damaging Het
Zfp39 A T 11: 58,890,120 Y605* probably null Het
Other mutations in Flnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Flnb APN 14 7917390 splice site probably benign
IGL01063:Flnb APN 14 7926518 splice site probably benign
IGL01135:Flnb APN 14 7909736 missense probably benign
IGL01139:Flnb APN 14 7945989 missense probably damaging 1.00
IGL01364:Flnb APN 14 7934562 critical splice acceptor site probably null
IGL01417:Flnb APN 14 7905513 missense probably damaging 0.99
IGL01505:Flnb APN 14 7902003 critical splice donor site probably null
IGL01560:Flnb APN 14 7893829 missense probably benign 0.07
IGL01621:Flnb APN 14 7950470 missense probably damaging 1.00
IGL01656:Flnb APN 14 7902010 splice site probably benign
IGL01889:Flnb APN 14 7935967 missense possibly damaging 0.85
IGL01987:Flnb APN 14 7922748 critical splice donor site probably null
IGL02322:Flnb APN 14 7894676 missense probably damaging 1.00
IGL02496:Flnb APN 14 7930919 splice site probably benign
IGL02752:Flnb APN 14 7917338 missense probably benign
IGL03001:Flnb APN 14 7934680 missense probably damaging 0.99
IGL03076:Flnb APN 14 7901988 missense probably benign 0.01
IGL03085:Flnb APN 14 7882211 missense probably benign
IGL03170:Flnb APN 14 7818261 missense possibly damaging 0.90
IGL03373:Flnb APN 14 7890867 critical splice donor site probably null
Boomerang UTSW 14 7901945 missense probably damaging 1.00
Queensland UTSW 14 7927352 missense probably damaging 1.00
R3437_Flnb_252 UTSW 14 7942057 missense probably damaging 0.97
R8441_Flnb_221 UTSW 14 7896488 missense probably benign 0.15
Rhodelinda UTSW 14 7887682 splice site probably benign
saul UTSW 14 7889183 missense probably damaging 0.99
Xerxes UTSW 14 7867551 missense probably damaging 1.00
R0068:Flnb UTSW 14 7915290 missense possibly damaging 0.49
R0068:Flnb UTSW 14 7915290 missense possibly damaging 0.49
R0084:Flnb UTSW 14 7935979 missense probably benign
R0128:Flnb UTSW 14 7901951 missense probably damaging 0.99
R0130:Flnb UTSW 14 7901951 missense probably damaging 0.99
R0148:Flnb UTSW 14 7939077 missense probably benign 0.01
R0166:Flnb UTSW 14 7896115 missense probably damaging 1.00
R0376:Flnb UTSW 14 7946014 critical splice donor site probably null
R0547:Flnb UTSW 14 7912943 splice site probably null
R0612:Flnb UTSW 14 7887682 splice site probably benign
R0656:Flnb UTSW 14 7927352 missense probably damaging 1.00
R0691:Flnb UTSW 14 7890810 missense probably benign 0.16
R1241:Flnb UTSW 14 7896503 missense probably benign 0.06
R1572:Flnb UTSW 14 7883908 missense probably damaging 0.97
R1682:Flnb UTSW 14 7913121 missense probably benign 0.04
R1807:Flnb UTSW 14 7934645 missense probably benign 0.26
R1848:Flnb UTSW 14 7892113 missense probably damaging 1.00
R1959:Flnb UTSW 14 7884735 nonsense probably null
R2078:Flnb UTSW 14 7927466 missense probably damaging 1.00
R2132:Flnb UTSW 14 7873376 missense probably benign 0.04
R2209:Flnb UTSW 14 7905507 nonsense probably null
R2212:Flnb UTSW 14 7881652 small deletion probably benign
R2213:Flnb UTSW 14 7881652 small deletion probably benign
R2363:Flnb UTSW 14 7945950 missense possibly damaging 0.95
R2415:Flnb UTSW 14 7929932 missense probably benign 0.07
R2983:Flnb UTSW 14 7882250 missense probably damaging 1.00
R3001:Flnb UTSW 14 7907162 missense probably benign 0.22
R3002:Flnb UTSW 14 7907162 missense probably benign 0.22
R3436:Flnb UTSW 14 7942057 missense probably damaging 0.97
R3437:Flnb UTSW 14 7942057 missense probably damaging 0.97
R3778:Flnb UTSW 14 7915353 missense probably benign 0.06
R3783:Flnb UTSW 14 7889236 missense probably benign 0.04
R4162:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4163:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4164:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4356:Flnb UTSW 14 7922700 missense probably benign
R4369:Flnb UTSW 14 7942216 missense probably benign
R4783:Flnb UTSW 14 7905701 missense probably benign 0.12
R4785:Flnb UTSW 14 7905701 missense probably benign 0.12
R4790:Flnb UTSW 14 7905661 missense probably benign 0.34
R4828:Flnb UTSW 14 7919238 missense probably benign 0.13
R4882:Flnb UTSW 14 7929936 missense possibly damaging 0.56
R5002:Flnb UTSW 14 7945882 missense probably damaging 1.00
R5058:Flnb UTSW 14 7924262 nonsense probably null
R5184:Flnb UTSW 14 7901945 missense probably damaging 1.00
R5186:Flnb UTSW 14 7909748 missense probably damaging 1.00
R5395:Flnb UTSW 14 7883881 missense probably benign 0.02
R5421:Flnb UTSW 14 7926494 missense probably damaging 1.00
R5667:Flnb UTSW 14 7890843 missense probably benign 0.00
R5671:Flnb UTSW 14 7890843 missense probably benign 0.00
R5714:Flnb UTSW 14 7929073 missense probably damaging 1.00
R5860:Flnb UTSW 14 7931135 missense probably damaging 1.00
R5892:Flnb UTSW 14 7907183 missense probably damaging 1.00
R5924:Flnb UTSW 14 7890765 missense probably benign 0.00
R6131:Flnb UTSW 14 7894635 missense possibly damaging 0.79
R6244:Flnb UTSW 14 7892092 missense probably damaging 1.00
R6489:Flnb UTSW 14 7867551 missense probably damaging 1.00
R6582:Flnb UTSW 14 7892275 critical splice donor site probably null
R6586:Flnb UTSW 14 7929138 missense possibly damaging 0.93
R6611:Flnb UTSW 14 7915318 missense probably damaging 1.00
R6626:Flnb UTSW 14 7929012 missense probably damaging 1.00
R6700:Flnb UTSW 14 7892189 missense probably damaging 0.99
R6738:Flnb UTSW 14 7904536 missense probably benign 0.01
R6864:Flnb UTSW 14 7905640 missense possibly damaging 0.84
R6916:Flnb UTSW 14 7907171 missense probably damaging 0.99
R7117:Flnb UTSW 14 7894214 missense probably benign 0.02
R7164:Flnb UTSW 14 7915944 splice site probably null
R7328:Flnb UTSW 14 7883788 missense possibly damaging 0.95
R7328:Flnb UTSW 14 7894660 nonsense probably null
R7687:Flnb UTSW 14 7924224 missense probably damaging 1.00
R7716:Flnb UTSW 14 7917274 missense possibly damaging 0.64
R7763:Flnb UTSW 14 7926478 missense probably benign 0.00
R7821:Flnb UTSW 14 7939113 missense probably benign 0.00
R7921:Flnb UTSW 14 7933800 missense possibly damaging 0.57
R8008:Flnb UTSW 14 7892155 missense probably damaging 1.00
R8075:Flnb UTSW 14 7913048 missense probably benign 0.00
R8084:Flnb UTSW 14 7907243 missense probably benign 0.00
R8259:Flnb UTSW 14 7889183 missense probably damaging 0.99
R8441:Flnb UTSW 14 7896488 missense probably benign 0.15
R8493:Flnb UTSW 14 7869822 missense probably damaging 0.97
R8508:Flnb UTSW 14 7950394 missense probably damaging 0.98
R8531:Flnb UTSW 14 7929939 missense probably damaging 1.00
R8812:Flnb UTSW 14 7887624 missense probably benign 0.06
R8814:Flnb UTSW 14 7927409 missense probably damaging 1.00
R8825:Flnb UTSW 14 7887566 missense probably damaging 1.00
R8868:Flnb UTSW 14 7908671 missense probably benign 0.02
R8955:Flnb UTSW 14 7892874 missense probably damaging 1.00
R8976:Flnb UTSW 14 7901882 critical splice acceptor site probably null
R9055:Flnb UTSW 14 7908553 missense probably benign 0.00
R9148:Flnb UTSW 14 7817996 start gained probably benign
R9179:Flnb UTSW 14 7887541 nonsense probably null
R9180:Flnb UTSW 14 7818219 missense probably damaging 1.00
R9189:Flnb UTSW 14 7892976 missense possibly damaging 0.90
R9286:Flnb UTSW 14 7873414 missense probably damaging 0.98
R9288:Flnb UTSW 14 7904498 missense probably benign 0.43
R9354:Flnb UTSW 14 7818411 missense probably benign 0.13
R9484:Flnb UTSW 14 7929004 missense probably benign 0.06
R9505:Flnb UTSW 14 7904665 missense probably benign
R9525:Flnb UTSW 14 7905481 missense probably damaging 1.00
R9621:Flnb UTSW 14 7926421 missense probably damaging 0.99
R9630:Flnb UTSW 14 7926438 nonsense probably null
R9739:Flnb UTSW 14 7935954 nonsense probably null
R9760:Flnb UTSW 14 7929846 missense probably damaging 0.98
X0066:Flnb UTSW 14 7908636 missense probably damaging 1.00
Z1088:Flnb UTSW 14 7905871 missense probably benign 0.04
Z1176:Flnb UTSW 14 7942066 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TTGCCATTGACACCAACGG -3'
(R):5'- AGAGGGTGGCTCAACTGTTG -3'

Sequencing Primer
(F):5'- CATTGACACCAACGGGGCAG -3'
(R):5'- TCAACTGTTGAGAGAACCTGGC -3'
Posted On 2021-08-31