Mutagenetix > Incidental Mutation

Incidental Mutation 'R8955:Ubr5'

681964

Institutional Source

Beutler Lab

Gene Symbol

Ubr5

Ensembl Gene

ENSMUSG00000037487

Gene Name

ubiquitin protein ligase E3 component n-recognin 5

Synonyms

Edd, 4432411E13Rik, Edd1

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_001081359.2, NM_001112721.1; MGI:1918040

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8955 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

37967328-38078854 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 38029581 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 467 (E467K)

Ref Sequence

ENSEMBL: ENSMUSP00000154293 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110336] [ENSMUST00000226414]

AlphaFold

no structure available at present

Predicted Effect

SMART Domains

Protein: ENSMUSP00000105965
Gene: ENSMUSG00000037487
AA Change: E461K

Domain	Start	End	E-Value	Type
low complexity region	94	111	N/A	INTRINSIC
low complexity region	129	156	N/A	INTRINSIC
Pfam:E3_UbLigase_EDD	179	230	9.7e-35	PFAM
low complexity region	282	323	N/A	INTRINSIC
low complexity region	614	628	N/A	INTRINSIC
low complexity region	860	870	N/A	INTRINSIC
low complexity region	933	950	N/A	INTRINSIC
low complexity region	970	999	N/A	INTRINSIC
low complexity region	1140	1151	N/A	INTRINSIC
ZnF_UBR1	1177	1244	5.42e-27	SMART
low complexity region	1396	1405	N/A	INTRINSIC
low complexity region	1524	1537	N/A	INTRINSIC
low complexity region	1567	1613	N/A	INTRINSIC
low complexity region	1641	1657	N/A	INTRINSIC
low complexity region	1662	1687	N/A	INTRINSIC
low complexity region	1726	1742	N/A	INTRINSIC
low complexity region	1759	1789	N/A	INTRINSIC
low complexity region	1879	1890	N/A	INTRINSIC
low complexity region	1972	1983	N/A	INTRINSIC
low complexity region	1986	1997	N/A	INTRINSIC
Blast:HECTc	2271	2313	2e-6	BLAST
low complexity region	2329	2366	N/A	INTRINSIC
PolyA	2389	2452	3.97e-33	SMART
HECTc	2432	2798	1e-151	SMART

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

Strain: 3052764
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a progestin-induced protein, which belongs to the HECT (homology to E6-AP carboxyl terminus) family. The HECT family proteins function as E3 ubiquitin-protein ligases, targeting specific proteins for ubiquitin-mediated proteolysis. This gene is localized to chromosome 8q22 which is disrupted in a variety of cancers. This gene potentially has a role in regulation of cell proliferation or differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, impaired growth of the allantois, failure or impairment of chorioallantoic fusion, impaired angiogenesis in the yolk sac and allantois, decreased cell proliferation, and increased apoptosis. [provided by MGI curators]

Allele List at MGI

All alleles(151) : Targeted(3) Gene trapped(148)

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy8	C	T	15: 64,704,705	V1003I	possibly damaging	Het
Adgra3	T	A	5: 49,961,389	Y939F	probably benign	Het
Adra2b	T	C	2: 127,363,584	V2A	probably benign	Het
Aga	T	A	8: 53,521,129	Y296N	possibly damaging	Het
Apc	A	G	18: 34,268,317	Q52R	probably damaging	Het
Arfgef1	A	T	1: 10,199,837	S362R	probably benign	Het
Arhgef7	C	T	8: 11,758,451		probably benign	Het
Bmp5	A	T	9: 75,898,553	M446L	probably damaging	Het
Carmil3	C	T	14: 55,496,077	T350I	probably damaging	Het
Cd44	T	A	2: 102,853,018	T224S	probably damaging	Het
Cep112	A	T	11: 108,752,434	I7F	possibly damaging	Het
Chrna2	G	A	14: 66,142,232	A7T	probably benign	Het
Cldn16	G	A	16: 26,482,520	V193I	probably benign	Het
Clec4a3	G	A	6: 122,966,520	E100K	possibly damaging	Het
Cntln	C	T	4: 85,067,873	T1026I	possibly damaging	Het
Cyp4v3	T	A	8: 45,308,527	I420F	probably benign	Het
Dcbld2	G	A	16: 58,450,762	A301T		Het
Dnah1	A	T	14: 31,285,993	D2152E	probably benign	Het
Dpy19l4	A	G	4: 11,290,195	V179A	probably benign	Het
Dusp4	T	A	8: 34,817,308	I259N	probably damaging	Het
Enpp1	T	A	10: 24,669,028	I318F	probably benign	Het
Entpd6	T	C	2: 150,753,085	V15A	possibly damaging	Het
Epb41l1	C	G	2: 156,522,003	Q811E	probably benign	Het
Epb41l5	T	C	1: 119,642,562	H32R	probably damaging	Het
Fam135b	C	T	15: 71,462,214	V1044I	possibly damaging	Het
Fat4	A	T	3: 38,983,629	H3810L	probably benign	Het
Fbxw28	T	A	9: 109,338,789		probably null	Het
Flnb	T	G	14: 7,892,874	V648G	probably damaging	Het
Flnb	T	A	14: 7,904,688	Y1030*	probably null	Het
Fndc3a	T	C	14: 72,556,970	T787A	probably benign	Het
Gli2	T	A	1: 118,855,457	H106L	probably damaging	Het
Gm10283	T	A	8: 60,501,356		probably null	Het
Gm3336	C	T	8: 70,721,896	R67*	probably null	Het
Gsr	T	G	8: 33,693,908	I399M	possibly damaging	Het
Gtf2ird2	T	A	5: 134,216,754	M618K	probably damaging	Het
Gtf3c3	T	A	1: 54,423,563	D347V	probably benign	Het
H2afy2	A	T	10: 61,757,831	I22N	probably damaging	Het
Hspa12a	T	C	19: 58,799,626	Y588C	probably damaging	Het
Il20ra	A	G	10: 19,759,412	E467G	possibly damaging	Het
Inf2	A	G	12: 112,610,564	I991V	unknown	Het
Irx6	T	C	8: 92,678,412	C303R	probably damaging	Het
Kcnmb4	T	A	10: 116,473,476	K16*	probably null	Het
Kirrel3	T	C	9: 34,944,442	L86P	probably damaging	Het
Lipo5	A	C	19: 33,473,130	F21V		Het
Lrmp	A	T	6: 145,171,664	M376L	probably benign	Het
Lrrc31	T	A	3: 30,679,118	R482S	probably benign	Het
Lrrc3b	C	T	14: 15,358,159	C149Y	probably damaging	Het
Lrrk1	A	G	7: 66,269,825	M446T	probably benign	Het
Mettl14	C	T	3: 123,374,044	D222N	probably benign	Het
Mfsd4b3	G	A	10: 39,948,076	H63Y	probably benign	Het
Myo16	T	C	8: 10,376,175	W311R	probably damaging	Het
Nccrp1	A	T	7: 28,546,203	N151K	probably benign	Het
Obsl1	T	C	1: 75,503,849	D377G	probably damaging	Het
Olfr1356	G	T	10: 78,847,742	P58T	probably damaging	Het
Olfr1447	T	A	19: 12,901,214	T189S	probably benign	Het
Olfr371	T	A	8: 85,231,284	I263N	probably benign	Het
Olfr508	T	A	7: 108,630,299	C102*	probably null	Het
Pigb	T	C	9: 73,038,701	N63S	probably damaging	Het
Plch2	T	C	4: 154,992,566	E577G	probably benign	Het
Prkab2	T	C	3: 97,666,627	V194A	probably benign	Het
Psd3	T	C	8: 67,963,809	I479V	probably benign	Het
Ralgapb	C	A	2: 158,437,344	P117T	probably benign	Het
Ralgapb	C	G	2: 158,495,469	T1116R	probably damaging	Het
Rpap2	T	A	5: 107,620,495	S400T	possibly damaging	Het
Rpgrip1l	C	A	8: 91,280,828	W378L	possibly damaging	Het
Rps20	T	A	4: 3,834,617	M82L	probably benign	Het
Rps5	T	C	7: 12,925,513	M77T	possibly damaging	Het
Scaf11	A	G	15: 96,420,490	S398P	probably damaging	Het
Sdf2	T	A	11: 78,254,937	D153E	probably benign	Het
Selplg	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	5: 113,819,695		probably benign	Het
Slc12a9	T	C	5: 137,331,008	N128S	probably damaging	Het
Slc25a32	C	A	15: 39,097,551	G246C	probably damaging	Het
Slc38a4	C	T	15: 97,016,781	A64T	probably benign	Het
Slit3	T	C	11: 35,698,380	V1254A	probably damaging	Het
Slx4	T	C	16: 3,990,247	K481R	probably benign	Het
Tcea1	A	G	1: 4,889,509	T136A	probably benign	Het
Thra	A	G	11: 98,753,623	D13G	possibly damaging	Het
Tmed9	G	A	13: 55,596,962	S227N	probably benign	Het
Trim80	C	A	11: 115,440,712	T20K	probably benign	Het
Trmt61a	G	T	12: 111,682,822	V276L	probably benign	Het
Trpc4ap	T	C	2: 155,666,251	D160G	possibly damaging	Het
Vars2	C	A	17: 35,661,649	G26W	probably damaging	Het
Vmn1r226	G	T	17: 20,688,025	R173L	possibly damaging	Het
Vmn1r29	G	T	6: 58,307,299	M1I	probably null	Het
Vmn2r3	G	T	3: 64,261,382	P578Q	possibly damaging	Het
Vmn2r57	A	T	7: 41,400,147	I726N	possibly damaging	Het
Zfp39	A	T	11: 58,890,120	Y605*	probably null	Het

Other mutations in Ubr5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Ubr5	APN	15	37984036	missense	probably damaging	1.00
IGL00548:Ubr5	APN	15	38004321	missense	probably benign	0.11
IGL00675:Ubr5	APN	15	38018284	missense	possibly damaging	0.84
IGL00770:Ubr5	APN	15	38006541	missense	probably benign	0.27
IGL00774:Ubr5	APN	15	38006541	missense	probably benign	0.27
IGL00919:Ubr5	APN	15	38040842	missense	probably damaging	1.00
IGL00962:Ubr5	APN	15	37985934	missense	probably damaging	1.00
IGL01328:Ubr5	APN	15	37981523	missense	possibly damaging	0.82
IGL01359:Ubr5	APN	15	37973006	missense	probably damaging	0.96
IGL01394:Ubr5	APN	15	38009631	missense	possibly damaging	0.90
IGL01674:Ubr5	APN	15	37998379	missense	probably damaging	1.00
IGL01981:Ubr5	APN	15	37996598	missense	probably benign	0.08
IGL01993:Ubr5	APN	15	37973012	missense	probably damaging	0.99
IGL02159:Ubr5	APN	15	37991379	splice site	probably benign
IGL02252:Ubr5	APN	15	38024894	missense	probably damaging	1.00
IGL02442:Ubr5	APN	15	38037901	missense	possibly damaging	0.95
IGL02502:Ubr5	APN	15	38030689	missense	probably benign	0.01
IGL02503:Ubr5	APN	15	38018320	missense	possibly damaging	0.90
IGL02503:Ubr5	APN	15	38018314	missense	probably damaging	0.99
IGL02546:Ubr5	APN	15	38008747	missense	probably benign	0.00
IGL02556:Ubr5	APN	15	38002448	missense	probably benign	0.18
IGL02647:Ubr5	APN	15	37992082	missense	probably damaging	0.99
IGL02679:Ubr5	APN	15	38002314	missense	probably benign	0.36
IGL02726:Ubr5	APN	15	38000562	splice site	probably benign
IGL02884:Ubr5	APN	15	37998376	missense	probably damaging	1.00
IGL02972:Ubr5	APN	15	38041952	missense	probably damaging	1.00
IGL03000:Ubr5	APN	15	38024852	missense	probably damaging	0.99
IGL03028:Ubr5	APN	15	38047593	missense	probably benign	0.00
IGL03057:Ubr5	APN	15	38040906	splice site	probably benign
IGL03085:Ubr5	APN	15	38029568	missense	probably damaging	1.00
IGL03198:Ubr5	APN	15	38045720	missense	probably damaging	1.00
IGL03368:Ubr5	APN	15	37998316	missense	probably damaging	0.96
Anchovy	UTSW	15	37979832	missense	probably null
P0016:Ubr5	UTSW	15	38000578	missense	probably damaging	1.00
PIT4142001:Ubr5	UTSW	15	38041909	missense
R0133:Ubr5	UTSW	15	37996571	missense	probably damaging	0.98
R0173:Ubr5	UTSW	15	38004675	missense	probably damaging	1.00
R0234:Ubr5	UTSW	15	37968493	missense	probably damaging	1.00
R0234:Ubr5	UTSW	15	37968493	missense	probably damaging	1.00
R0314:Ubr5	UTSW	15	37997187	missense	probably damaging	0.99
R0379:Ubr5	UTSW	15	38018957	missense	probably benign	0.00
R0390:Ubr5	UTSW	15	38030672	missense	probably benign	0.19
R0415:Ubr5	UTSW	15	37972980	missense	probably damaging	0.98
R0531:Ubr5	UTSW	15	37991344	missense	probably benign	0.34
R0650:Ubr5	UTSW	15	38030807	splice site	probably benign
R0720:Ubr5	UTSW	15	37972991	missense	probably damaging	0.98
R1183:Ubr5	UTSW	15	37997175	missense	possibly damaging	0.71
R1302:Ubr5	UTSW	15	38041479	missense	possibly damaging	0.91
R1442:Ubr5	UTSW	15	38014924	splice site	probably benign
R1507:Ubr5	UTSW	15	37980870	missense	probably damaging	1.00
R1575:Ubr5	UTSW	15	38040841	missense	probably damaging	1.00
R1577:Ubr5	UTSW	15	38030730	missense	possibly damaging	0.76
R1622:Ubr5	UTSW	15	38009113	unclassified	probably benign
R1721:Ubr5	UTSW	15	38041846	missense	probably benign	0.18
R1799:Ubr5	UTSW	15	37989377	missense	probably damaging	1.00
R1840:Ubr5	UTSW	15	37980917	missense	possibly damaging	0.51
R1867:Ubr5	UTSW	15	38041846	missense	probably benign	0.18
R1868:Ubr5	UTSW	15	38041846	missense	probably benign	0.18
R2065:Ubr5	UTSW	15	38040842	missense	probably damaging	1.00
R2107:Ubr5	UTSW	15	37989302	missense	probably benign	0.00
R2201:Ubr5	UTSW	15	38002299	missense	possibly damaging	0.83
R2261:Ubr5	UTSW	15	37988284	missense	probably damaging	0.99
R2441:Ubr5	UTSW	15	37989345	missense	probably damaging	0.99
R2512:Ubr5	UTSW	15	38002319	missense	probably damaging	1.00
R3008:Ubr5	UTSW	15	38030845	missense	probably benign
R3412:Ubr5	UTSW	15	38004235	splice site	probably benign
R3898:Ubr5	UTSW	15	37997739	missense	probably benign	0.02
R3900:Ubr5	UTSW	15	38019242	missense	probably damaging	1.00
R4032:Ubr5	UTSW	15	38024837	missense
R4352:Ubr5	UTSW	15	38041573	missense	probably benign	0.31
R4362:Ubr5	UTSW	15	38078403	missense	probably damaging	0.99
R4467:Ubr5	UTSW	15	38004336	missense	probably damaging	1.00
R4507:Ubr5	UTSW	15	38013542	missense	probably damaging	0.96
R4683:Ubr5	UTSW	15	38037967	missense	probably damaging	1.00
R4771:Ubr5	UTSW	15	38018297	missense	possibly damaging	0.50
R4878:Ubr5	UTSW	15	38006564	missense	probably benign	0.01
R4999:Ubr5	UTSW	15	38009668	missense	probably benign	0.06
R5057:Ubr5	UTSW	15	38004109	missense	probably damaging	0.98
R5177:Ubr5	UTSW	15	38006517	missense	probably benign	0.22
R5186:Ubr5	UTSW	15	37997916	missense	probably damaging	0.99
R5378:Ubr5	UTSW	15	37989578	missense	probably damaging	1.00
R5486:Ubr5	UTSW	15	38008739	missense	probably benign	0.00
R5494:Ubr5	UTSW	15	38019281	missense	possibly damaging	0.78
R5617:Ubr5	UTSW	15	38030657	missense	possibly damaging	0.47
R5636:Ubr5	UTSW	15	37983996	missense	probably damaging	1.00
R5655:Ubr5	UTSW	15	38015093	missense	probably damaging	0.99
R5715:Ubr5	UTSW	15	38002233	missense	probably benign	0.06
R5781:Ubr5	UTSW	15	38006541	missense	probably benign	0.27
R6645:Ubr5	UTSW	15	38029506	missense	probably damaging	1.00
R6774:Ubr5	UTSW	15	38015135	missense	probably damaging	1.00
R6823:Ubr5	UTSW	15	37989598	missense	probably benign	0.08
R6877:Ubr5	UTSW	15	38002570	missense	probably damaging	0.98
R7105:Ubr5	UTSW	15	38008775	missense
R7166:Ubr5	UTSW	15	37976145	missense
R7514:Ubr5	UTSW	15	37988237	missense
R7523:Ubr5	UTSW	15	38004055	missense
R7631:Ubr5	UTSW	15	38029507	missense
R7709:Ubr5	UTSW	15	37979832	missense	probably null
R7710:Ubr5	UTSW	15	37979832	missense	probably null
R7712:Ubr5	UTSW	15	37979832	missense	probably null
R7803:Ubr5	UTSW	15	37979832	missense	probably null
R7816:Ubr5	UTSW	15	37979832	missense	probably null
R7817:Ubr5	UTSW	15	37979832	missense	probably null
R7821:Ubr5	UTSW	15	37997187	missense	probably damaging	0.96
R7824:Ubr5	UTSW	15	37991322	missense	probably damaging	0.97
R7841:Ubr5	UTSW	15	37980906	missense
R7869:Ubr5	UTSW	15	37979832	missense	probably null
R7896:Ubr5	UTSW	15	38041573	missense	probably benign	0.31
R8191:Ubr5	UTSW	15	38006507	missense
R8342:Ubr5	UTSW	15	38024837	missense
R8745:Ubr5	UTSW	15	38024795	missense
R8811:Ubr5	UTSW	15	38040879	missense
R8904:Ubr5	UTSW	15	38041909	missense
R8956:Ubr5	UTSW	15	38015123	missense	probably damaging	1.00
R9051:Ubr5	UTSW	15	38002259	missense
R9102:Ubr5	UTSW	15	38018352	missense
R9183:Ubr5	UTSW	15	37997176	missense
R9235:Ubr5	UTSW	15	38045738	missense
R9392:Ubr5	UTSW	15	37984007	missense
R9473:Ubr5	UTSW	15	38002373	missense
R9596:Ubr5	UTSW	15	37985969	missense
R9659:Ubr5	UTSW	15	37984010	missense
R9683:Ubr5	UTSW	15	37978027	missense
RF024:Ubr5	UTSW	15	38028652	missense
X0024:Ubr5	UTSW	15	37992060	missense	probably damaging	1.00
Z1177:Ubr5	UTSW	15	38040755	missense

Predicted Primers

PCR Primer
(F):5'- GATTGCTAAGCATACAGTGTTTGC -3'
(R):5'- CAAGCATTTTAGACCTGGAGTC -3'

Sequencing Primer
(F):5'- CGGCTTTAAAGGGAAACTCCTTC -3'
(R):5'- TAGTGTTGACCACAGCTC -3'

Posted On

2021-08-31