Mutagenetix > Incidental Mutation

Incidental Mutation 'R8955:Slx4'

681970

Institutional Source

Beutler Lab

Gene Symbol

Slx4

Ensembl Gene

ENSMUSG00000039738

Gene Name

SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)

Synonyms

Btbd12, D16Bwg1016e

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8955 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

3979105-4003770 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 3990247 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 481 (K481R)

Ref Sequence

ENSEMBL: ENSMUSP00000038871 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040790]

AlphaFold

Q6P1D7

Predicted Effect

probably benign
Transcript: ENSMUST00000040790
AA Change: K481R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000038871
Gene: ENSMUSG00000039738
AA Change: K481R

Domain	Start	End	E-Value	Type
low complexity region	400	413	N/A	INTRINSIC
BTB	506	609	6.15e-7	SMART
low complexity region	651	667	N/A	INTRINSIC
low complexity region	833	849	N/A	INTRINSIC
low complexity region	857	875	N/A	INTRINSIC
low complexity region	1176	1192	N/A	INTRINSIC
low complexity region	1437	1461	N/A	INTRINSIC
Pfam:Slx4	1484	1541	3e-17	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000146569

SMART Domains

Protein: ENSMUSP00000126423
Gene: ENSMUSG00000039738

Domain	Start	End	E-Value	Type
Pfam:BTB	6	102	6.7e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000156542

Predicted Effect

probably benign
Transcript: ENSMUST00000165830

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein containing a BTB (POZ) domain that comprises a subunit of structure-specific endonucleases. The encoded protein aids in the resolution of DNA secondary structures that arise during the processes of DNA repair and recombination. Knock out of this gene in mouse recapitulates the phenotype of the human disease Fanconi anemia, including blood cytopenia and susceptibility to genomic instability. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit some preweaning lethality, reduced fertility, abnormal eye morphology, abnormal skeletal morphology, hydrocephalus, chromosomal instability, early cellular replicative senescence, and abnormal lymphopoeisis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy8	C	T	15: 64,704,705	V1003I	possibly damaging	Het
Adgra3	T	A	5: 49,961,389	Y939F	probably benign	Het
Adra2b	T	C	2: 127,363,584	V2A	probably benign	Het
Aga	T	A	8: 53,521,129	Y296N	possibly damaging	Het
Apc	A	G	18: 34,268,317	Q52R	probably damaging	Het
Arfgef1	A	T	1: 10,199,837	S362R	probably benign	Het
Arhgef7	C	T	8: 11,758,451		probably benign	Het
Bmp5	A	T	9: 75,898,553	M446L	probably damaging	Het
Carmil3	C	T	14: 55,496,077	T350I	probably damaging	Het
Cd44	T	A	2: 102,853,018	T224S	probably damaging	Het
Cep112	A	T	11: 108,752,434	I7F	possibly damaging	Het
Chrna2	G	A	14: 66,142,232	A7T	probably benign	Het
Cldn16	G	A	16: 26,482,520	V193I	probably benign	Het
Clec4a3	G	A	6: 122,966,520	E100K	possibly damaging	Het
Cntln	C	T	4: 85,067,873	T1026I	possibly damaging	Het
Cyp4v3	T	A	8: 45,308,527	I420F	probably benign	Het
Dcbld2	G	A	16: 58,450,762	A301T		Het
Dnah1	A	T	14: 31,285,993	D2152E	probably benign	Het
Dpy19l4	A	G	4: 11,290,195	V179A	probably benign	Het
Dusp4	T	A	8: 34,817,308	I259N	probably damaging	Het
Enpp1	T	A	10: 24,669,028	I318F	probably benign	Het
Entpd6	T	C	2: 150,753,085	V15A	possibly damaging	Het
Epb41l1	C	G	2: 156,522,003	Q811E	probably benign	Het
Epb41l5	T	C	1: 119,642,562	H32R	probably damaging	Het
Fam135b	C	T	15: 71,462,214	V1044I	possibly damaging	Het
Fat4	A	T	3: 38,983,629	H3810L	probably benign	Het
Fbxw28	T	A	9: 109,338,789		probably null	Het
Flnb	T	G	14: 7,892,874	V648G	probably damaging	Het
Flnb	T	A	14: 7,904,688	Y1030*	probably null	Het
Fndc3a	T	C	14: 72,556,970	T787A	probably benign	Het
Gli2	T	A	1: 118,855,457	H106L	probably damaging	Het
Gm10283	T	A	8: 60,501,356		probably null	Het
Gm3336	C	T	8: 70,721,896	R67*	probably null	Het
Gsr	T	G	8: 33,693,908	I399M	possibly damaging	Het
Gtf2ird2	T	A	5: 134,216,754	M618K	probably damaging	Het
Gtf3c3	T	A	1: 54,423,563	D347V	probably benign	Het
H2afy2	A	T	10: 61,757,831	I22N	probably damaging	Het
Hspa12a	T	C	19: 58,799,626	Y588C	probably damaging	Het
Il20ra	A	G	10: 19,759,412	E467G	possibly damaging	Het
Inf2	A	G	12: 112,610,564	I991V	unknown	Het
Irx6	T	C	8: 92,678,412	C303R	probably damaging	Het
Kcnmb4	T	A	10: 116,473,476	K16*	probably null	Het
Kirrel3	T	C	9: 34,944,442	L86P	probably damaging	Het
Lipo5	A	C	19: 33,473,130	F21V		Het
Lrmp	A	T	6: 145,171,664	M376L	probably benign	Het
Lrrc31	T	A	3: 30,679,118	R482S	probably benign	Het
Lrrc3b	C	T	14: 15,358,159	C149Y	probably damaging	Het
Lrrk1	A	G	7: 66,269,825	M446T	probably benign	Het
Mettl14	C	T	3: 123,374,044	D222N	probably benign	Het
Mfsd4b3	G	A	10: 39,948,076	H63Y	probably benign	Het
Myo16	T	C	8: 10,376,175	W311R	probably damaging	Het
Nccrp1	A	T	7: 28,546,203	N151K	probably benign	Het
Obsl1	T	C	1: 75,503,849	D377G	probably damaging	Het
Olfr1356	G	T	10: 78,847,742	P58T	probably damaging	Het
Olfr1447	T	A	19: 12,901,214	T189S	probably benign	Het
Olfr371	T	A	8: 85,231,284	I263N	probably benign	Het
Olfr508	T	A	7: 108,630,299	C102*	probably null	Het
Pigb	T	C	9: 73,038,701	N63S	probably damaging	Het
Plch2	T	C	4: 154,992,566	E577G	probably benign	Het
Prkab2	T	C	3: 97,666,627	V194A	probably benign	Het
Psd3	T	C	8: 67,963,809	I479V	probably benign	Het
Ralgapb	C	A	2: 158,437,344	P117T	probably benign	Het
Ralgapb	C	G	2: 158,495,469	T1116R	probably damaging	Het
Rpap2	T	A	5: 107,620,495	S400T	possibly damaging	Het
Rpgrip1l	C	A	8: 91,280,828	W378L	possibly damaging	Het
Rps20	T	A	4: 3,834,617	M82L	probably benign	Het
Rps5	T	C	7: 12,925,513	M77T	possibly damaging	Het
Scaf11	A	G	15: 96,420,490	S398P	probably damaging	Het
Sdf2	T	A	11: 78,254,937	D153E	probably benign	Het
Selplg	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	5: 113,819,695		probably benign	Het
Slc12a9	T	C	5: 137,331,008	N128S	probably damaging	Het
Slc25a32	C	A	15: 39,097,551	G246C	probably damaging	Het
Slc38a4	C	T	15: 97,016,781	A64T	probably benign	Het
Slit3	T	C	11: 35,698,380	V1254A	probably damaging	Het
Tcea1	A	G	1: 4,889,509	T136A	probably benign	Het
Thra	A	G	11: 98,753,623	D13G	possibly damaging	Het
Tmed9	G	A	13: 55,596,962	S227N	probably benign	Het
Trim80	C	A	11: 115,440,712	T20K	probably benign	Het
Trmt61a	G	T	12: 111,682,822	V276L	probably benign	Het
Trpc4ap	T	C	2: 155,666,251	D160G	possibly damaging	Het
Ubr5	C	T	15: 38,029,581	E467K		Het
Vars2	C	A	17: 35,661,649	G26W	probably damaging	Het
Vmn1r226	G	T	17: 20,688,025	R173L	possibly damaging	Het
Vmn1r29	G	T	6: 58,307,299	M1I	probably null	Het
Vmn2r3	G	T	3: 64,261,382	P578Q	possibly damaging	Het
Vmn2r57	A	T	7: 41,400,147	I726N	possibly damaging	Het
Zfp39	A	T	11: 58,890,120	Y605*	probably null	Het

Other mutations in Slx4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01143:Slx4	APN	16	3990888	missense	probably benign	0.17
IGL01767:Slx4	APN	16	3990248	missense	probably benign	0.01
IGL02525:Slx4	APN	16	3980597	missense	probably damaging	1.00
slim	UTSW	16	3990910	nonsense	probably null
R0033:Slx4	UTSW	16	3988000	missense	probably benign	0.08
R0070:Slx4	UTSW	16	3988016	missense	possibly damaging	0.71
R0070:Slx4	UTSW	16	3988016	missense	possibly damaging	0.71
R0242:Slx4	UTSW	16	3986952	missense	probably damaging	0.99
R0242:Slx4	UTSW	16	3986952	missense	probably damaging	0.99
R0363:Slx4	UTSW	16	3980089	missense	probably damaging	1.00
R0433:Slx4	UTSW	16	3986018	missense	probably benign	0.01
R0993:Slx4	UTSW	16	3985825	missense	probably benign	0.00
R1083:Slx4	UTSW	16	3990910	nonsense	probably null
R1373:Slx4	UTSW	16	3985510	missense	probably benign	0.02
R1710:Slx4	UTSW	16	3999158	missense	probably benign	0.15
R1712:Slx4	UTSW	16	3991594	missense	probably damaging	0.99
R1874:Slx4	UTSW	16	3986848	missense	probably benign	0.25
R1937:Slx4	UTSW	16	3987166	makesense	probably null
R2008:Slx4	UTSW	16	3979921	missense	probably damaging	1.00
R2156:Slx4	UTSW	16	3986359	missense	probably benign	0.00
R2427:Slx4	UTSW	16	3988987	missense	probably damaging	0.99
R3765:Slx4	UTSW	16	3980986	missense	probably damaging	1.00
R3890:Slx4	UTSW	16	3979909	missense	probably damaging	1.00
R3891:Slx4	UTSW	16	3979909	missense	probably damaging	1.00
R4465:Slx4	UTSW	16	3989055	missense	possibly damaging	0.82
R4467:Slx4	UTSW	16	3989055	missense	possibly damaging	0.82
R4497:Slx4	UTSW	16	3994909	missense	probably damaging	1.00
R4882:Slx4	UTSW	16	3980996	critical splice acceptor site	probably null
R5119:Slx4	UTSW	16	4001199	missense	possibly damaging	0.89
R5384:Slx4	UTSW	16	3990805	missense	probably damaging	1.00
R5472:Slx4	UTSW	16	3991540	missense	probably benign	0.13
R5578:Slx4	UTSW	16	3986862	missense	probably damaging	1.00
R5582:Slx4	UTSW	16	3985788	missense	possibly damaging	0.93
R5696:Slx4	UTSW	16	3979967	missense	probably damaging	1.00
R5827:Slx4	UTSW	16	4001284	missense	possibly damaging	0.94
R5964:Slx4	UTSW	16	4000951	critical splice donor site	probably null
R6032:Slx4	UTSW	16	3980157	missense	probably damaging	1.00
R6032:Slx4	UTSW	16	3980157	missense	probably damaging	1.00
R6039:Slx4	UTSW	16	3986047	missense	possibly damaging	0.82
R6039:Slx4	UTSW	16	3986047	missense	possibly damaging	0.82
R6345:Slx4	UTSW	16	3990850	missense	probably benign	0.06
R6612:Slx4	UTSW	16	3985276	missense	probably damaging	0.99
R6979:Slx4	UTSW	16	3985015	missense	probably damaging	0.96
R6989:Slx4	UTSW	16	3995838	missense	probably damaging	1.00
R7171:Slx4	UTSW	16	3990786	missense	probably benign
R7214:Slx4	UTSW	16	3988980	missense	probably benign	0.18
R7354:Slx4	UTSW	16	3987099	missense	probably benign	0.28
R7490:Slx4	UTSW	16	3980131	missense	possibly damaging	0.91
R7545:Slx4	UTSW	16	3999300	missense	probably benign	0.11
R7547:Slx4	UTSW	16	3985572	missense	probably benign	0.05
R7790:Slx4	UTSW	16	3986982	missense	probably benign	0.03
R8119:Slx4	UTSW	16	3985272	nonsense	probably null
R8815:Slx4	UTSW	16	3985594	missense	probably benign	0.26
R9205:Slx4	UTSW	16	3988063	missense	possibly damaging	0.74
R9321:Slx4	UTSW	16	3986790	missense	probably benign	0.06
R9364:Slx4	UTSW	16	3987956	missense	probably benign	0.00
R9544:Slx4	UTSW	16	3980053	missense	probably damaging	0.97
R9554:Slx4	UTSW	16	3987956	missense	probably benign	0.00
R9632:Slx4	UTSW	16	3986105	missense	probably benign	0.00
R9665:Slx4	UTSW	16	3989026	missense	probably benign	0.28
R9718:Slx4	UTSW	16	3986464	missense	possibly damaging	0.73
R9772:Slx4	UTSW	16	4000985	missense

Predicted Primers

PCR Primer
(F):5'- TATCCAGGCACAGCAATGGC -3'
(R):5'- CTACTTCCCTGTGATGGAGATG -3'

Sequencing Primer
(F):5'- CAGAAGACGTTGTGGCAATGACC -3'
(R):5'- GGAGAGTTGCTTTAAGTAAAGATGTC -3'

Posted On

2021-08-31