Incidental Mutation 'R8956:Atf6'
ID 681984
Institutional Source Beutler Lab
Gene Symbol Atf6
Ensembl Gene ENSMUSG00000026663
Gene Name activating transcription factor 6
Synonyms 9130025P16Rik, ESTM49, Atf6alpha
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock # R8956 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 170704674-170867771 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 170794007 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 482 (T482A)
Ref Sequence ENSEMBL: ENSMUSP00000027974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027974]
AlphaFold F6VAN0
Predicted Effect probably damaging
Transcript: ENSMUST00000027974
AA Change: T482A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027974
Gene: ENSMUSG00000026663
AA Change: T482A

DomainStartEndE-ValueType
low complexity region 78 101 N/A INTRINSIC
low complexity region 109 121 N/A INTRINSIC
low complexity region 168 178 N/A INTRINSIC
BRLZ 291 355 2.72e-16 SMART
Blast:BRLZ 384 419 5e-6 BLAST
low complexity region 445 457 N/A INTRINSIC
low complexity region 631 650 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that activates target genes for the unfolded protein response (UPR) during endoplasmic reticulum (ER) stress. Although it is a transcription factor, this protein is unusual in that it is synthesized as a transmembrane protein that is embedded in the ER. It functions as an ER stress sensor/transducer, and following ER stress-induced proteolysis, it functions as a nuclear transcription factor via a cis-acting ER stress response element (ERSE) that is present in the promoters of genes encoding ER chaperones. This protein has been identified as a survival factor for quiescent but not proliferative squamous carcinoma cells. There have been conflicting reports about the association of polymorphisms in this gene with diabetes in different populations, but another polymorphism has been associated with increased plasma cholesterol levels. This gene is also thought to be a potential therapeutic target for cystic fibrosis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to dithiothreitol, thapsigargin, and tunicamycin. Mice homozygous for a conditional allele activated in islet cells exhibit reduced sensitivity to TUDCA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan C T 7: 79,100,965 T1828I probably benign Het
Acsf2 A G 11: 94,570,385 S322P probably benign Het
Acss2 T A 2: 155,549,518 I170N probably damaging Het
Adam22 G A 5: 8,092,343 T814I probably damaging Het
Agrn G T 4: 156,166,538 D1914E probably damaging Het
Akap6 T C 12: 53,140,344 S1514P probably benign Het
Akap9 T C 5: 3,948,805 L58P possibly damaging Het
Apof A G 10: 128,269,843 I289V probably benign Het
Arhgap35 G A 7: 16,614,479 probably benign Het
Atad3a A C 4: 155,753,597 F239L probably damaging Het
Atp8b4 T A 2: 126,325,407 probably null Het
B4galt5 T C 2: 167,301,340 Y388C probably damaging Het
Bahd1 T C 2: 118,919,208 L495P probably damaging Het
Bcl6 T C 16: 23,974,966 E77G probably damaging Het
Bst1 C A 5: 43,825,374 S187* probably null Het
Car4 A G 11: 84,964,551 N170S probably null Het
Cdk14 A T 5: 5,227,182 V131E probably damaging Het
Cdk4 T A 10: 127,064,677 probably benign Het
Cebpe T C 14: 54,711,664 R99G probably damaging Het
Col9a1 G A 1: 24,237,219 G736D probably damaging Het
Copa T A 1: 172,109,913 V477D possibly damaging Het
Coq9 G A 8: 94,850,258 G166D probably benign Het
Cttnbp2 A T 6: 18,434,166 N564K possibly damaging Het
Dgkq T C 5: 108,650,229 N721S probably benign Het
Dnhd1 A T 7: 105,692,645 Y1217F probably damaging Het
Eef1akmt4 G T 16: 20,618,648 E247* probably null Het
Elmsan1 T A 12: 84,162,328 I667L probably benign Het
Elovl7 A T 13: 108,256,786 I18F probably benign Het
Eml5 T C 12: 98,852,693 K785E possibly damaging Het
Faap100 C A 11: 120,377,359 C196F probably damaging Het
Fat2 G A 11: 55,282,903 T2328M probably damaging Het
Gcnt2 T A 13: 40,887,728 I121N probably benign Het
Gm12253 A G 11: 58,436,779 K152E probably benign Het
Gm16440 T A 14: 6,387,488 R167* probably null Het
Gm43302 T A 5: 105,277,736 I276F possibly damaging Het
Gys2 A G 6: 142,428,541 S593P probably damaging Het
H2-M10.4 T A 17: 36,461,353 N168Y probably benign Het
Hpca C A 4: 129,118,494 R83L probably damaging Het
Igkv8-28 A G 6: 70,144,125 F13L probably benign Het
Il17ra A T 6: 120,481,504 I539F probably damaging Het
Kdm4a A G 4: 118,161,816 V401A possibly damaging Het
Krt86 A T 15: 101,477,276 T351S probably benign Het
Lig4 A G 8: 9,971,378 C801R probably benign Het
Lrrn4 G A 2: 132,872,091 P312S probably damaging Het
Macf1 T A 4: 123,474,848 H2040L probably benign Het
Madcam1 A G 10: 79,666,632 K317E possibly damaging Het
Maip1 T C 1: 57,411,802 I201T probably damaging Het
Map4k4 C A 1: 40,000,680 D513E probably benign Het
Mpped1 G A 15: 83,856,268 G137R probably damaging Het
Mrgprd T G 7: 145,322,186 F265V probably benign Het
Myct1 C T 10: 5,604,208 T25I probably damaging Het
Mylk A G 16: 34,971,409 T1484A probably benign Het
Nbas C T 12: 13,432,922 S1400L possibly damaging Het
Nedd4 T A 9: 72,726,426 S405T probably benign Het
Neil2 A G 14: 63,191,778 V22A probably damaging Het
Nrip1 G C 16: 76,292,305 A788G probably benign Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr1535 T C 13: 21,555,999 I8V probably benign Het
Olfr456 T A 6: 42,486,896 Q99L probably damaging Het
Olfr479 A G 7: 108,055,953 T324A probably benign Het
Olfr811 C T 10: 129,802,353 M57I possibly damaging Het
Olfr961 C T 9: 39,647,200 T158I probably damaging Het
Orc2 T C 1: 58,466,062 N478S probably damaging Het
Oxct1 A G 15: 4,035,324 E48G possibly damaging Het
Pcca A G 14: 122,737,912 I28V probably benign Het
Pcdha8 T C 18: 36,993,188 V241A probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pkd2 T A 5: 104,483,224 W505R probably damaging Het
Plxnc1 C T 10: 94,910,586 V430I probably benign Het
Prkd3 A G 17: 78,971,454 M401T probably damaging Het
Rgmb A G 17: 15,807,486 C324R probably benign Het
Rsph6a A T 7: 19,065,439 probably benign Het
Sclt1 A T 3: 41,681,774 M264K probably benign Het
Serhl T A 15: 83,101,698 V30D possibly damaging Het
Sfrp1 T C 8: 23,412,143 V120A probably damaging Het
Slc22a8 C T 19: 8,609,666 Q408* probably null Het
Slc35b2 A G 17: 45,566,747 T218A probably damaging Het
Slco4c1 A T 1: 96,837,517 F403I probably damaging Het
Sorbs1 T A 19: 40,363,216 H250L probably damaging Het
Sorcs3 T A 19: 48,749,371 C742* probably null Het
Tmem8 T A 17: 26,120,400 S563T possibly damaging Het
Tnc T C 4: 64,000,733 Y1151C probably damaging Het
Trim9 T C 12: 70,346,891 Q93R probably damaging Het
Tsnaxip1 A G 8: 105,844,181 Y613C probably damaging Het
Ttc6 C T 12: 57,728,410 Q1631* probably null Het
Ubr5 A G 15: 38,015,123 L881P probably damaging Het
Upp2 C T 2: 58,567,442 probably benign Het
Vmn1r203 T A 13: 22,524,834 S262T possibly damaging Het
Vmn2r116 A T 17: 23,386,762 D216V probably damaging Het
Vps52 A G 17: 33,958,075 Q96R probably benign Het
Other mutations in Atf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Atf6 APN 1 170788606 critical splice donor site probably null
IGL01431:Atf6 APN 1 170853002 splice site probably benign
IGL01755:Atf6 APN 1 170788611 missense possibly damaging 0.63
IGL02060:Atf6 APN 1 170819420 missense probably damaging 0.99
IGL02416:Atf6 APN 1 170747157 nonsense probably null
IGL02903:Atf6 APN 1 170799714 missense probably benign 0.00
IGL02989:Atf6 APN 1 170788683 splice site probably benign
IGL03209:Atf6 APN 1 170834894 missense probably benign
R0455:Atf6 UTSW 1 170834923 missense probably benign 0.00
R0467:Atf6 UTSW 1 170794020 missense probably damaging 1.00
R0491:Atf6 UTSW 1 170787344 critical splice donor site probably null
R0784:Atf6 UTSW 1 170709947 missense probably benign 0.19
R1486:Atf6 UTSW 1 170794691 missense probably damaging 1.00
R1850:Atf6 UTSW 1 170819286 missense probably damaging 1.00
R1945:Atf6 UTSW 1 170855141 missense probably benign 0.00
R2164:Atf6 UTSW 1 170794735 missense probably damaging 1.00
R3782:Atf6 UTSW 1 170794767 nonsense probably null
R4454:Atf6 UTSW 1 170794039 missense probably damaging 0.99
R4631:Atf6 UTSW 1 170747197 splice site probably null
R4676:Atf6 UTSW 1 170787410 missense probably damaging 1.00
R5772:Atf6 UTSW 1 170747189 missense probably damaging 1.00
R5860:Atf6 UTSW 1 170841775 missense probably damaging 1.00
R5860:Atf6 UTSW 1 170841776 missense possibly damaging 0.95
R5950:Atf6 UTSW 1 170834879 missense probably damaging 1.00
R6242:Atf6 UTSW 1 170793976 missense possibly damaging 0.46
R6520:Atf6 UTSW 1 170867669 missense probably benign 0.00
R7032:Atf6 UTSW 1 170799612 critical splice donor site probably null
R7472:Atf6 UTSW 1 170815491 missense possibly damaging 0.83
R7923:Atf6 UTSW 1 170794706 missense probably benign
R8002:Atf6 UTSW 1 170819254 missense probably benign 0.43
R8860:Atf6 UTSW 1 170852966 missense probably null 0.95
R9090:Atf6 UTSW 1 170794676 missense probably damaging 1.00
R9271:Atf6 UTSW 1 170794676 missense probably damaging 1.00
R9323:Atf6 UTSW 1 170855113 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAGAAGCAGCCACAGTGAG -3'
(R):5'- GGAGGTTACCTTATAACAATCCATGTC -3'

Sequencing Primer
(F):5'- GAAGTAAATGAGGCTGAAGTTCCC -3'
(R):5'- CTGTTCTTTGGGTCCTATAG -3'
Posted On 2021-08-31