Incidental Mutation 'R8956:Acan'
ID682014
Institutional Source Beutler Lab
Gene Symbol Acan
Ensembl Gene ENSMUSG00000030607
Gene Nameaggrecan
SynonymsAgc1, b2b183Clo, Cspg1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8956 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location79053483-79115099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 79100965 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1828 (T1828I)
Ref Sequence ENSEMBL: ENSMUSP00000032835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032835]
Predicted Effect probably benign
Transcript: ENSMUST00000032835
AA Change: T1828I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000032835
Gene: ENSMUSG00000030607
AA Change: T1828I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 46 135 3.46e-7 SMART
LINK 151 248 1.76e-59 SMART
LINK 252 350 4.13e-65 SMART
LINK 485 582 1.03e-51 SMART
LINK 586 684 9.58e-61 SMART
low complexity region 767 794 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 890 904 N/A INTRINSIC
low complexity region 913 930 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1707 1720 N/A INTRINSIC
low complexity region 1808 1823 N/A INTRINSIC
low complexity region 1904 1915 N/A INTRINSIC
CLECT 1922 2043 2.13e-37 SMART
CCP 2049 2105 9.32e-11 SMART
low complexity region 2118 2130 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Spontaneous mutations in this gene lead to dwarfism, cartilage, skeletal and limb anomalies, craniofacial defects, hearing loss and neonatal death due to respiratory failure. Homozygotes for an ENU-induced allele show cardiomyopathy as well as cleft palate, disproportionate dwarfism and brachypodia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf2 A G 11: 94,570,385 S322P probably benign Het
Acss2 T A 2: 155,549,518 I170N probably damaging Het
Adam22 G A 5: 8,092,343 T814I probably damaging Het
Agrn G T 4: 156,166,538 D1914E probably damaging Het
Akap6 T C 12: 53,140,344 S1514P probably benign Het
Akap9 T C 5: 3,948,805 L58P possibly damaging Het
Apof A G 10: 128,269,843 I289V probably benign Het
Arhgap35 G A 7: 16,614,479 probably benign Het
Atad3a A C 4: 155,753,597 F239L probably damaging Het
Atf6 T C 1: 170,794,007 T482A probably damaging Het
Atp8b4 T A 2: 126,325,407 probably null Het
B4galt5 T C 2: 167,301,340 Y388C probably damaging Het
Bahd1 T C 2: 118,919,208 L495P probably damaging Het
Bcl6 T C 16: 23,974,966 E77G probably damaging Het
Bst1 C A 5: 43,825,374 S187* probably null Het
Car4 A G 11: 84,964,551 N170S probably null Het
Cdk14 A T 5: 5,227,182 V131E probably damaging Het
Cdk4 T A 10: 127,064,677 probably benign Het
Cebpe T C 14: 54,711,664 R99G probably damaging Het
Col9a1 G A 1: 24,237,219 G736D probably damaging Het
Copa T A 1: 172,109,913 V477D possibly damaging Het
Coq9 G A 8: 94,850,258 G166D probably benign Het
Cttnbp2 A T 6: 18,434,166 N564K possibly damaging Het
Dgkq T C 5: 108,650,229 N721S probably benign Het
Dnhd1 A T 7: 105,692,645 Y1217F probably damaging Het
Eef1akmt4 G T 16: 20,618,648 E247* probably null Het
Elmsan1 T A 12: 84,162,328 I667L probably benign Het
Elovl7 A T 13: 108,256,786 I18F probably benign Het
Eml5 T C 12: 98,852,693 K785E possibly damaging Het
Faap100 C A 11: 120,377,359 C196F probably damaging Het
Fat2 G A 11: 55,282,903 T2328M probably damaging Het
Gcnt2 T A 13: 40,887,728 I121N probably benign Het
Gm12253 A G 11: 58,436,779 K152E probably benign Het
Gm16440 T A 14: 6,387,488 R167* probably null Het
Gm43302 T A 5: 105,277,736 I276F possibly damaging Het
Gys2 A G 6: 142,428,541 S593P probably damaging Het
H2-M10.4 T A 17: 36,461,353 N168Y probably benign Het
Hpca C A 4: 129,118,494 R83L probably damaging Het
Igkv8-28 A G 6: 70,144,125 F13L probably benign Het
Il17ra A T 6: 120,481,504 I539F probably damaging Het
Kdm4a A G 4: 118,161,816 V401A possibly damaging Het
Krt86 A T 15: 101,477,276 T351S probably benign Het
Lig4 A G 8: 9,971,378 C801R probably benign Het
Lrrn4 G A 2: 132,872,091 P312S probably damaging Het
Macf1 T A 4: 123,474,848 H2040L probably benign Het
Madcam1 A G 10: 79,666,632 K317E possibly damaging Het
Maip1 T C 1: 57,411,802 I201T probably damaging Het
Map4k4 C A 1: 40,000,680 D513E probably benign Het
Mpped1 G A 15: 83,856,268 G137R probably damaging Het
Mrgprd T G 7: 145,322,186 F265V probably benign Het
Myct1 C T 10: 5,604,208 T25I probably damaging Het
Mylk A G 16: 34,971,409 T1484A probably benign Het
Nbas C T 12: 13,432,922 S1400L possibly damaging Het
Nedd4 T A 9: 72,726,426 S405T probably benign Het
Neil2 A G 14: 63,191,778 V22A probably damaging Het
Nrip1 G C 16: 76,292,305 A788G probably benign Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr1535 T C 13: 21,555,999 I8V probably benign Het
Olfr456 T A 6: 42,486,896 Q99L probably damaging Het
Olfr479 A G 7: 108,055,953 T324A probably benign Het
Olfr811 C T 10: 129,802,353 M57I possibly damaging Het
Olfr961 C T 9: 39,647,200 T158I probably damaging Het
Orc2 T C 1: 58,466,062 N478S probably damaging Het
Oxct1 A G 15: 4,035,324 E48G possibly damaging Het
Pcca A G 14: 122,737,912 I28V probably benign Het
Pcdha8 T C 18: 36,993,188 V241A probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pkd2 T A 5: 104,483,224 W505R probably damaging Het
Plxnc1 C T 10: 94,910,586 V430I probably benign Het
Prkd3 A G 17: 78,971,454 M401T probably damaging Het
Rgmb A G 17: 15,807,486 C324R probably benign Het
Rsph6a A T 7: 19,065,439 probably benign Het
Sclt1 A T 3: 41,681,774 M264K probably benign Het
Serhl T A 15: 83,101,698 V30D possibly damaging Het
Sfrp1 T C 8: 23,412,143 V120A probably damaging Het
Slc22a8 C T 19: 8,609,666 Q408* probably null Het
Slc35b2 A G 17: 45,566,747 T218A probably damaging Het
Slco4c1 A T 1: 96,837,517 F403I probably damaging Het
Sorbs1 T A 19: 40,363,216 H250L probably damaging Het
Sorcs3 T A 19: 48,749,371 C742* probably null Het
Tmem8 T A 17: 26,120,400 S563T possibly damaging Het
Tnc T C 4: 64,000,733 Y1151C probably damaging Het
Trim9 T C 12: 70,346,891 Q93R probably damaging Het
Tsnaxip1 A G 8: 105,844,181 Y613C probably damaging Het
Ttc6 C T 12: 57,728,410 Q1631* probably null Het
Ubr5 A G 15: 38,015,123 L881P probably damaging Het
Upp2 C T 2: 58,567,442 probably benign Het
Vmn1r203 T A 13: 22,524,834 S262T possibly damaging Het
Vmn2r116 A T 17: 23,386,762 D216V probably damaging Het
Vps52 A G 17: 33,958,075 Q96R probably benign Het
Other mutations in Acan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Acan APN 7 79097824 missense probably benign 0.00
IGL01118:Acan APN 7 79098653 missense possibly damaging 0.78
IGL01145:Acan APN 7 79099282 missense probably damaging 1.00
IGL01308:Acan APN 7 79099249 missense probably damaging 0.98
IGL01520:Acan APN 7 79084570 missense probably damaging 0.96
IGL02069:Acan APN 7 79092752 missense possibly damaging 0.83
IGL02629:Acan APN 7 79111979 missense possibly damaging 0.90
IGL02713:Acan APN 7 79100244 missense possibly damaging 0.90
IGL03001:Acan APN 7 79111294 missense probably damaging 0.99
IGL03081:Acan APN 7 79098543 missense probably benign 0.01
Hollowleg UTSW 7 79098348 nonsense probably null
Sublimate UTSW 7 79111320 missense probably damaging 0.97
Vacuo UTSW 7 79088307 critical splice donor site probably null
IGL03147:Acan UTSW 7 79091056 missense probably damaging 1.00
R0281:Acan UTSW 7 79100285 missense probably damaging 1.00
R0372:Acan UTSW 7 79100601 missense probably benign 0.00
R0599:Acan UTSW 7 79111290 splice site probably benign
R0827:Acan UTSW 7 79099671 missense probably benign 0.00
R0835:Acan UTSW 7 79114232 missense probably damaging 0.96
R1496:Acan UTSW 7 79100804 missense probably benign 0.06
R1716:Acan UTSW 7 79082198 missense unknown
R1761:Acan UTSW 7 79094085 nonsense probably null
R1848:Acan UTSW 7 79099035 missense probably benign
R2002:Acan UTSW 7 79100793 missense probably damaging 1.00
R2025:Acan UTSW 7 79101222 missense probably benign
R2167:Acan UTSW 7 79099957 missense probably benign 0.41
R2189:Acan UTSW 7 79098091 missense probably damaging 1.00
R2303:Acan UTSW 7 79099957 missense probably benign 0.41
R2496:Acan UTSW 7 79111317 missense probably damaging 1.00
R2971:Acan UTSW 7 79099699 missense possibly damaging 0.46
R4004:Acan UTSW 7 79100687 missense probably damaging 1.00
R4669:Acan UTSW 7 79101142 missense probably benign 0.01
R4732:Acan UTSW 7 79098609 missense probably damaging 0.99
R4733:Acan UTSW 7 79098609 missense probably damaging 0.99
R4742:Acan UTSW 7 79100769 missense probably benign 0.41
R4750:Acan UTSW 7 79092718 missense probably damaging 1.00
R5022:Acan UTSW 7 79092808 critical splice donor site probably null
R5122:Acan UTSW 7 79100661 missense probably damaging 0.99
R5190:Acan UTSW 7 79098541 missense probably benign 0.03
R5220:Acan UTSW 7 79088297 missense probably damaging 0.96
R5414:Acan UTSW 7 79100988 missense probably benign 0.00
R5525:Acan UTSW 7 79099983 missense probably benign
R5655:Acan UTSW 7 79100043 missense possibly damaging 0.89
R5662:Acan UTSW 7 79100107 missense possibly damaging 0.78
R5748:Acan UTSW 7 79089699 missense probably damaging 0.98
R5758:Acan UTSW 7 79101214 missense possibly damaging 0.67
R5996:Acan UTSW 7 79111320 missense probably damaging 0.97
R6057:Acan UTSW 7 79099782 missense probably null
R6503:Acan UTSW 7 79097832 missense probably benign 0.04
R6529:Acan UTSW 7 79089731 missense probably benign 0.16
R6887:Acan UTSW 7 79092483 missense probably damaging 1.00
R7041:Acan UTSW 7 79098348 nonsense probably null
R7193:Acan UTSW 7 79086342 missense probably damaging 1.00
R7220:Acan UTSW 7 79108148 missense
R7263:Acan UTSW 7 79092318 missense probably damaging 0.98
R7376:Acan UTSW 7 79088307 critical splice donor site probably null
R7502:Acan UTSW 7 79094203 missense probably damaging 1.00
R7571:Acan UTSW 7 79086267 missense probably damaging 1.00
R7709:Acan UTSW 7 79089608 missense probably damaging 1.00
R7835:Acan UTSW 7 79099875 missense probably benign 0.08
R8051:Acan UTSW 7 79100779 missense probably damaging 0.96
R8131:Acan UTSW 7 79091338 missense possibly damaging 0.92
R8138:Acan UTSW 7 79098427 missense probably benign 0.12
R8324:Acan UTSW 7 79091056 missense probably damaging 1.00
R8482:Acan UTSW 7 79096744 missense probably benign 0.02
R8511:Acan UTSW 7 79097935 missense possibly damaging 0.94
R8716:Acan UTSW 7 79112690 missense probably damaging 1.00
R8753:Acan UTSW 7 79098768 missense possibly damaging 0.83
R8810:Acan UTSW 7 79099704 missense probably damaging 1.00
R8898:Acan UTSW 7 79100353 missense possibly damaging 0.59
RF008:Acan UTSW 7 79092400 missense possibly damaging 0.83
Z1088:Acan UTSW 7 79088200 nonsense probably null
Z1088:Acan UTSW 7 79100110 missense probably benign 0.41
Z1088:Acan UTSW 7 79111354 missense probably benign
Z1176:Acan UTSW 7 79111354 missense probably benign
Z1177:Acan UTSW 7 79094170 missense probably damaging 0.96
Z1177:Acan UTSW 7 79100137 missense probably damaging 0.99
Z1177:Acan UTSW 7 79111354 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCCAGCAGTAAACTGTCTG -3'
(R):5'- GGTCTCCTCTCCTGAGTATGAG -3'

Sequencing Primer
(F):5'- GAGTTCCCAGATCTGCATGGAATC -3'
(R):5'- CTCCTCTCCTGAGTATGAGGGATTTG -3'
Posted On2021-08-31