Incidental Mutation 'R8956:Mylk'
ID 682057
Institutional Source Beutler Lab
Gene Symbol Mylk
Ensembl Gene ENSMUSG00000022836
Gene Name myosin, light polypeptide kinase
Synonyms Mlck, telokin, nmMlck, 9530072E15Rik, A930019C19Rik, MLCK108, MLCK210
MMRRC Submission 068792-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8956 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 34565580-34822790 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34791779 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1484 (T1484A)
Ref Sequence ENSEMBL: ENSMUSP00000023538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023538]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000023538
AA Change: T1484A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: T1484A

DomainStartEndE-ValueType
IGc2 54 122 9.05e-11 SMART
IGc2 177 244 3.94e-11 SMART
Pfam:23ISL 255 409 3.6e-60 PFAM
IGc2 423 491 1.55e-9 SMART
IGc2 523 587 3.32e-18 SMART
IGc2 632 699 6.02e-7 SMART
IGc2 730 798 1.36e-5 SMART
low complexity region 827 844 N/A INTRINSIC
IGc2 1141 1208 2.42e-11 SMART
low complexity region 1251 1269 N/A INTRINSIC
IG 1275 1359 4.56e-7 SMART
FN3 1362 1444 2.33e-11 SMART
low complexity region 1457 1479 N/A INTRINSIC
S_TKc 1495 1750 4.23e-95 SMART
IGc2 1852 1920 5.92e-15 SMART
low complexity region 1934 1950 N/A INTRINSIC
Meta Mutation Damage Score 0.0707 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan C T 7: 78,750,713 (GRCm39) T1828I probably benign Het
Acsf2 A G 11: 94,461,211 (GRCm39) S322P probably benign Het
Acss2 T A 2: 155,391,438 (GRCm39) I170N probably damaging Het
Adam22 G A 5: 8,142,343 (GRCm39) T814I probably damaging Het
Agrn G T 4: 156,250,995 (GRCm39) D1914E probably damaging Het
Akap6 T C 12: 53,187,127 (GRCm39) S1514P probably benign Het
Akap9 T C 5: 3,998,805 (GRCm39) L58P possibly damaging Het
Apof A G 10: 128,105,712 (GRCm39) I289V probably benign Het
Arhgap35 G A 7: 16,348,404 (GRCm39) probably benign Het
Atad3a A C 4: 155,838,054 (GRCm39) F239L probably damaging Het
Atf6 T C 1: 170,621,576 (GRCm39) T482A probably damaging Het
Atg9b T C 5: 24,591,850 (GRCm39) probably benign Het
Atp8b4 T A 2: 126,167,327 (GRCm39) probably null Het
B4galt5 T C 2: 167,143,260 (GRCm39) Y388C probably damaging Het
Bahd1 T C 2: 118,749,689 (GRCm39) L495P probably damaging Het
Bcl6 T C 16: 23,793,716 (GRCm39) E77G probably damaging Het
Bst1 C A 5: 43,982,716 (GRCm39) S187* probably null Het
Car4 A G 11: 84,855,377 (GRCm39) N170S probably null Het
Cdk14 A T 5: 5,277,182 (GRCm39) V131E probably damaging Het
Cdk4 T A 10: 126,900,546 (GRCm39) probably benign Het
Cebpe T C 14: 54,949,121 (GRCm39) R99G probably damaging Het
Col9a1 G A 1: 24,276,300 (GRCm39) G736D probably damaging Het
Copa T A 1: 171,937,480 (GRCm39) V477D possibly damaging Het
Coq9 G A 8: 95,576,886 (GRCm39) G166D probably benign Het
Cttnbp2 A T 6: 18,434,165 (GRCm39) N564K possibly damaging Het
Dgkq T C 5: 108,798,095 (GRCm39) N721S probably benign Het
Dnhd1 A T 7: 105,341,852 (GRCm39) Y1217F probably damaging Het
Eef1akmt4 G T 16: 20,437,398 (GRCm39) E247* probably null Het
Elovl7 A T 13: 108,393,320 (GRCm39) I18F probably benign Het
Eml5 T C 12: 98,818,952 (GRCm39) K785E possibly damaging Het
Faap100 C A 11: 120,268,185 (GRCm39) C196F probably damaging Het
Fat2 G A 11: 55,173,729 (GRCm39) T2328M probably damaging Het
Gcnt2 T A 13: 41,041,204 (GRCm39) I121N probably benign Het
Gm12253 A G 11: 58,327,605 (GRCm39) K152E probably benign Het
Gm16440 T A 14: 17,574,527 (GRCm39) R167* probably null Het
Gm43302 T A 5: 105,425,602 (GRCm39) I276F possibly damaging Het
Gys2 A G 6: 142,374,267 (GRCm39) S593P probably damaging Het
H2-M10.4 T A 17: 36,772,245 (GRCm39) N168Y probably benign Het
Hpca C A 4: 129,012,287 (GRCm39) R83L probably damaging Het
Igkv8-28 A G 6: 70,121,109 (GRCm39) F13L probably benign Het
Il17ra A T 6: 120,458,465 (GRCm39) I539F probably damaging Het
Kdm4a A G 4: 118,019,013 (GRCm39) V401A possibly damaging Het
Krt86 A T 15: 101,375,157 (GRCm39) T351S probably benign Het
Lig4 A G 8: 10,021,378 (GRCm39) C801R probably benign Het
Lrrn4 G A 2: 132,714,011 (GRCm39) P312S probably damaging Het
Macf1 T A 4: 123,368,641 (GRCm39) H2040L probably benign Het
Madcam1 A G 10: 79,502,466 (GRCm39) K317E possibly damaging Het
Maip1 T C 1: 57,450,961 (GRCm39) I201T probably damaging Het
Map4k4 C A 1: 40,039,840 (GRCm39) D513E probably benign Het
Mideas T A 12: 84,209,102 (GRCm39) I667L probably benign Het
Mpped1 G A 15: 83,740,469 (GRCm39) G137R probably damaging Het
Mrgprd T G 7: 144,875,923 (GRCm39) F265V probably benign Het
Myct1 C T 10: 5,554,208 (GRCm39) T25I probably damaging Het
Nbas C T 12: 13,482,923 (GRCm39) S1400L possibly damaging Het
Nedd4 T A 9: 72,633,708 (GRCm39) S405T probably benign Het
Neil2 A G 14: 63,429,227 (GRCm39) V22A probably damaging Het
Nrip1 G C 16: 76,089,193 (GRCm39) A788G probably benign Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,236,850 (GRCm39) probably benign Het
Or10ab4 A G 7: 107,655,160 (GRCm39) T324A probably benign Het
Or10d4c C T 9: 39,558,496 (GRCm39) T158I probably damaging Het
Or2b7 T C 13: 21,740,169 (GRCm39) I8V probably benign Het
Or2bd2 G A 7: 6,442,020 (GRCm39) probably benign Het
Or2r2 T A 6: 42,463,830 (GRCm39) Q99L probably damaging Het
Or6c215 C T 10: 129,638,222 (GRCm39) M57I possibly damaging Het
Orc2 T C 1: 58,505,221 (GRCm39) N478S probably damaging Het
Oxct1 A G 15: 4,064,806 (GRCm39) E48G possibly damaging Het
Pcca A G 14: 122,975,324 (GRCm39) I28V probably benign Het
Pcdha8 T C 18: 37,126,241 (GRCm39) V241A probably benign Het
Pgap6 T A 17: 26,339,374 (GRCm39) S563T possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Pkd2 T A 5: 104,631,090 (GRCm39) W505R probably damaging Het
Plxnc1 C T 10: 94,746,448 (GRCm39) V430I probably benign Het
Prkd3 A G 17: 79,278,883 (GRCm39) M401T probably damaging Het
Rgmb A G 17: 16,027,748 (GRCm39) C324R probably benign Het
Rsph6a A T 7: 18,799,364 (GRCm39) probably benign Het
Sclt1 A T 3: 41,636,209 (GRCm39) M264K probably benign Het
Serhl T A 15: 82,985,899 (GRCm39) V30D possibly damaging Het
Sfrp1 T C 8: 23,902,159 (GRCm39) V120A probably damaging Het
Slc22a8 C T 19: 8,587,030 (GRCm39) Q408* probably null Het
Slc35b2 A G 17: 45,877,673 (GRCm39) T218A probably damaging Het
Slco4c1 A T 1: 96,765,242 (GRCm39) F403I probably damaging Het
Sorbs1 T A 19: 40,351,660 (GRCm39) H250L probably damaging Het
Sorcs3 T A 19: 48,737,810 (GRCm39) C742* probably null Het
Tnc T C 4: 63,918,970 (GRCm39) Y1151C probably damaging Het
Tor1aip1 T A 1: 155,909,582 (GRCm39) probably benign Het
Trim9 T C 12: 70,393,665 (GRCm39) Q93R probably damaging Het
Tsnaxip1 A G 8: 106,570,813 (GRCm39) Y613C probably damaging Het
Ttc6 C T 12: 57,775,196 (GRCm39) Q1631* probably null Het
Ubr5 A G 15: 38,015,367 (GRCm39) L881P probably damaging Het
Upp2 C T 2: 58,457,454 (GRCm39) probably benign Het
Vmn1r203 T A 13: 22,709,004 (GRCm39) S262T possibly damaging Het
Vmn2r116 A T 17: 23,605,736 (GRCm39) D216V probably damaging Het
Vps52 A G 17: 34,177,049 (GRCm39) Q96R probably benign Het
Other mutations in Mylk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Mylk APN 16 34,759,322 (GRCm39) missense probably benign 0.36
IGL01386:Mylk APN 16 34,791,610 (GRCm39) critical splice acceptor site probably null
IGL01684:Mylk APN 16 34,792,310 (GRCm39) missense possibly damaging 0.55
IGL01884:Mylk APN 16 34,809,247 (GRCm39) splice site probably benign
IGL02079:Mylk APN 16 34,681,001 (GRCm39) missense possibly damaging 0.87
IGL02104:Mylk APN 16 34,635,805 (GRCm39) missense probably benign 0.06
IGL02624:Mylk APN 16 34,750,266 (GRCm39) missense probably benign 0.29
IGL02756:Mylk APN 16 34,784,016 (GRCm39) missense probably benign 0.42
IGL02794:Mylk APN 16 34,806,911 (GRCm39) missense probably benign 0.21
IGL02833:Mylk APN 16 34,735,270 (GRCm39) missense probably benign 0.01
IGL02946:Mylk APN 16 34,742,158 (GRCm39) missense probably benign 0.10
IGL03012:Mylk APN 16 34,773,151 (GRCm39) missense probably benign 0.03
IGL03093:Mylk APN 16 34,732,562 (GRCm39) missense possibly damaging 0.62
IGL03272:Mylk APN 16 34,799,559 (GRCm39) missense probably benign 0.09
billy UTSW 16 34,695,990 (GRCm39) missense probably damaging 0.97
brutus UTSW 16 34,774,065 (GRCm39) missense probably benign 0.12
Club UTSW 16 34,732,645 (GRCm39) nonsense probably null
popeye UTSW 16 34,783,947 (GRCm39) missense probably benign 0.29
F5770:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
P4717OSA:Mylk UTSW 16 34,797,483 (GRCm39) splice site probably benign
PIT4382001:Mylk UTSW 16 34,696,012 (GRCm39) missense probably damaging 0.99
R0131:Mylk UTSW 16 34,695,874 (GRCm39) missense probably benign 0.03
R0309:Mylk UTSW 16 34,732,667 (GRCm39) splice site probably benign
R0358:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0381:Mylk UTSW 16 34,605,344 (GRCm39) splice site probably null
R0390:Mylk UTSW 16 34,695,990 (GRCm39) missense probably damaging 0.97
R0413:Mylk UTSW 16 34,742,314 (GRCm39) missense probably benign 0.01
R0536:Mylk UTSW 16 34,820,757 (GRCm39) missense possibly damaging 0.95
R0544:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0545:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0546:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0547:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0548:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0627:Mylk UTSW 16 34,820,799 (GRCm39) missense probably damaging 1.00
R0726:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0755:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0782:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0783:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0784:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R1136:Mylk UTSW 16 34,820,688 (GRCm39) missense probably damaging 1.00
R1170:Mylk UTSW 16 34,694,409 (GRCm39) missense probably benign 0.20
R1222:Mylk UTSW 16 34,681,022 (GRCm39) missense probably benign 0.12
R1445:Mylk UTSW 16 34,635,835 (GRCm39) missense possibly damaging 0.57
R1583:Mylk UTSW 16 34,695,956 (GRCm39) missense probably benign 0.29
R1618:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R1643:Mylk UTSW 16 34,696,005 (GRCm39) missense probably benign 0.03
R1702:Mylk UTSW 16 34,742,314 (GRCm39) missense probably benign 0.00
R1776:Mylk UTSW 16 34,773,152 (GRCm39) missense probably benign 0.16
R1865:Mylk UTSW 16 34,732,600 (GRCm39) missense probably benign 0.03
R1975:Mylk UTSW 16 34,700,673 (GRCm39) splice site probably null
R2016:Mylk UTSW 16 34,817,187 (GRCm39) missense probably damaging 1.00
R2045:Mylk UTSW 16 34,774,023 (GRCm39) missense probably benign 0.29
R2134:Mylk UTSW 16 34,806,846 (GRCm39) missense probably benign 0.13
R3547:Mylk UTSW 16 34,700,538 (GRCm39) missense possibly damaging 0.61
R3844:Mylk UTSW 16 34,742,247 (GRCm39) missense probably benign 0.01
R4003:Mylk UTSW 16 34,783,947 (GRCm39) missense probably benign 0.29
R4396:Mylk UTSW 16 34,732,645 (GRCm39) nonsense probably null
R4470:Mylk UTSW 16 34,732,522 (GRCm39) missense probably benign 0.09
R4507:Mylk UTSW 16 34,774,065 (GRCm39) missense probably benign 0.12
R4700:Mylk UTSW 16 34,742,805 (GRCm39) missense probably benign 0.16
R4751:Mylk UTSW 16 34,699,539 (GRCm39) missense probably benign 0.29
R4815:Mylk UTSW 16 34,715,295 (GRCm39) missense probably damaging 0.97
R4832:Mylk UTSW 16 34,742,737 (GRCm39) missense probably benign 0.36
R4872:Mylk UTSW 16 34,735,360 (GRCm39) missense possibly damaging 0.89
R4953:Mylk UTSW 16 34,809,331 (GRCm39) missense probably damaging 1.00
R4969:Mylk UTSW 16 34,791,810 (GRCm39) missense probably damaging 0.96
R5009:Mylk UTSW 16 34,719,877 (GRCm39) missense probably benign 0.39
R5130:Mylk UTSW 16 34,809,367 (GRCm39) missense probably damaging 1.00
R5173:Mylk UTSW 16 34,797,383 (GRCm39) missense probably benign 0.40
R5195:Mylk UTSW 16 34,799,585 (GRCm39) missense probably damaging 1.00
R5209:Mylk UTSW 16 34,742,995 (GRCm39) missense possibly damaging 0.55
R5311:Mylk UTSW 16 34,742,127 (GRCm39) missense probably benign 0.01
R5418:Mylk UTSW 16 34,732,600 (GRCm39) missense probably benign 0.02
R5481:Mylk UTSW 16 34,741,974 (GRCm39) missense probably benign 0.09
R5590:Mylk UTSW 16 34,699,722 (GRCm39) missense probably benign 0.29
R5603:Mylk UTSW 16 34,776,862 (GRCm39) missense probably benign 0.06
R5823:Mylk UTSW 16 34,715,317 (GRCm39) critical splice donor site probably null
R6290:Mylk UTSW 16 34,715,213 (GRCm39) missense probably benign 0.39
R6351:Mylk UTSW 16 34,742,341 (GRCm39) missense probably benign 0.01
R6365:Mylk UTSW 16 34,680,961 (GRCm39) missense probably benign 0.12
R6490:Mylk UTSW 16 34,750,237 (GRCm39) missense possibly damaging 0.74
R6723:Mylk UTSW 16 34,750,258 (GRCm39) missense possibly damaging 0.74
R6864:Mylk UTSW 16 34,694,520 (GRCm39) missense probably benign 0.03
R6908:Mylk UTSW 16 34,700,643 (GRCm39) missense probably benign 0.18
R6949:Mylk UTSW 16 34,820,688 (GRCm39) missense probably damaging 1.00
R7018:Mylk UTSW 16 34,820,796 (GRCm39) missense possibly damaging 0.88
R7035:Mylk UTSW 16 34,797,352 (GRCm39) missense possibly damaging 0.89
R7162:Mylk UTSW 16 34,742,899 (GRCm39) missense probably damaging 1.00
R7236:Mylk UTSW 16 34,742,899 (GRCm39) missense probably damaging 1.00
R7269:Mylk UTSW 16 34,605,381 (GRCm39) missense probably damaging 0.96
R7475:Mylk UTSW 16 34,734,446 (GRCm39) splice site probably null
R7525:Mylk UTSW 16 34,809,357 (GRCm39) missense probably benign 0.06
R7587:Mylk UTSW 16 34,742,887 (GRCm39) missense probably benign 0.29
R7607:Mylk UTSW 16 34,715,184 (GRCm39) missense probably benign 0.09
R7616:Mylk UTSW 16 34,699,927 (GRCm39) missense probably damaging 0.97
R7647:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7648:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7764:Mylk UTSW 16 34,742,553 (GRCm39) missense probably benign 0.16
R7890:Mylk UTSW 16 34,784,018 (GRCm39) nonsense probably null
R7892:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7893:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R8065:Mylk UTSW 16 34,792,389 (GRCm39) missense probably benign 0.08
R8067:Mylk UTSW 16 34,792,389 (GRCm39) missense probably benign 0.08
R8143:Mylk UTSW 16 34,734,525 (GRCm39) missense possibly damaging 0.87
R8210:Mylk UTSW 16 34,820,721 (GRCm39) missense probably damaging 1.00
R8271:Mylk UTSW 16 34,742,949 (GRCm39) missense probably damaging 0.97
R8540:Mylk UTSW 16 34,750,257 (GRCm39) missense possibly damaging 0.87
R8721:Mylk UTSW 16 34,817,176 (GRCm39) missense probably damaging 1.00
R8743:Mylk UTSW 16 34,741,427 (GRCm39) missense probably benign 0.03
R8798:Mylk UTSW 16 34,719,772 (GRCm39) missense possibly damaging 0.89
R9131:Mylk UTSW 16 34,776,835 (GRCm39) missense probably benign 0.29
R9403:Mylk UTSW 16 34,696,012 (GRCm39) nonsense probably null
R9624:Mylk UTSW 16 34,699,677 (GRCm39) missense probably benign 0.29
R9735:Mylk UTSW 16 34,735,179 (GRCm39) missense probably benign 0.09
R9756:Mylk UTSW 16 34,734,387 (GRCm39) missense probably damaging 0.96
R9763:Mylk UTSW 16 34,699,482 (GRCm39) nonsense probably null
RF001:Mylk UTSW 16 34,699,741 (GRCm39) missense probably benign 0.03
V7580:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
V7583:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
X0065:Mylk UTSW 16 34,820,811 (GRCm39) missense probably damaging 1.00
Z1177:Mylk UTSW 16 34,743,021 (GRCm39) missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TTGCTCTGGGTAGCCTTCAG -3'
(R):5'- AGACTCTTGGTTTTGGAAGAAGCG -3'

Sequencing Primer
(F):5'- GGGTAGCCTTCAGTACTAATCAC -3'
(R):5'- GCGGTGTCTGAGAGAACAC -3'
Posted On 2021-08-31