Incidental Mutation 'R8956:Mylk'
ID 682057
Institutional Source Beutler Lab
Gene Symbol Mylk
Ensembl Gene ENSMUSG00000022836
Gene Name myosin, light polypeptide kinase
Synonyms Mlck, nmMlck, telokin, A930019C19Rik, 9530072E15Rik, MLCK108, MLCK210
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8956 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 34745210-35002420 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34971409 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1484 (T1484A)
Ref Sequence ENSEMBL: ENSMUSP00000023538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023538]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000023538
AA Change: T1484A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: T1484A

DomainStartEndE-ValueType
IGc2 54 122 9.05e-11 SMART
IGc2 177 244 3.94e-11 SMART
Pfam:23ISL 255 409 3.6e-60 PFAM
IGc2 423 491 1.55e-9 SMART
IGc2 523 587 3.32e-18 SMART
IGc2 632 699 6.02e-7 SMART
IGc2 730 798 1.36e-5 SMART
low complexity region 827 844 N/A INTRINSIC
IGc2 1141 1208 2.42e-11 SMART
low complexity region 1251 1269 N/A INTRINSIC
IG 1275 1359 4.56e-7 SMART
FN3 1362 1444 2.33e-11 SMART
low complexity region 1457 1479 N/A INTRINSIC
S_TKc 1495 1750 4.23e-95 SMART
IGc2 1852 1920 5.92e-15 SMART
low complexity region 1934 1950 N/A INTRINSIC
Meta Mutation Damage Score 0.0707 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan C T 7: 79,100,965 T1828I probably benign Het
Acsf2 A G 11: 94,570,385 S322P probably benign Het
Acss2 T A 2: 155,549,518 I170N probably damaging Het
Adam22 G A 5: 8,092,343 T814I probably damaging Het
Agrn G T 4: 156,166,538 D1914E probably damaging Het
Akap6 T C 12: 53,140,344 S1514P probably benign Het
Akap9 T C 5: 3,948,805 L58P possibly damaging Het
Apof A G 10: 128,269,843 I289V probably benign Het
Arhgap35 G A 7: 16,614,479 probably benign Het
Atad3a A C 4: 155,753,597 F239L probably damaging Het
Atf6 T C 1: 170,794,007 T482A probably damaging Het
Atg9b T C 5: 24,386,852 probably benign Het
Atp8b4 T A 2: 126,325,407 probably null Het
B4galt5 T C 2: 167,301,340 Y388C probably damaging Het
Bahd1 T C 2: 118,919,208 L495P probably damaging Het
Bcl6 T C 16: 23,974,966 E77G probably damaging Het
Bst1 C A 5: 43,825,374 S187* probably null Het
Car4 A G 11: 84,964,551 N170S probably null Het
Cdk14 A T 5: 5,227,182 V131E probably damaging Het
Cdk4 T A 10: 127,064,677 probably benign Het
Cebpe T C 14: 54,711,664 R99G probably damaging Het
Col9a1 G A 1: 24,237,219 G736D probably damaging Het
Copa T A 1: 172,109,913 V477D possibly damaging Het
Coq9 G A 8: 94,850,258 G166D probably benign Het
Cttnbp2 A T 6: 18,434,166 N564K possibly damaging Het
Dgkq T C 5: 108,650,229 N721S probably benign Het
Dnhd1 A T 7: 105,692,645 Y1217F probably damaging Het
Eef1akmt4 G T 16: 20,618,648 E247* probably null Het
Elmsan1 T A 12: 84,162,328 I667L probably benign Het
Elovl7 A T 13: 108,256,786 I18F probably benign Het
Eml5 T C 12: 98,852,693 K785E possibly damaging Het
Faap100 C A 11: 120,377,359 C196F probably damaging Het
Fat2 G A 11: 55,282,903 T2328M probably damaging Het
Gcnt2 T A 13: 40,887,728 I121N probably benign Het
Gm12253 A G 11: 58,436,779 K152E probably benign Het
Gm16440 T A 14: 6,387,488 R167* probably null Het
Gm43302 T A 5: 105,277,736 I276F possibly damaging Het
Gys2 A G 6: 142,428,541 S593P probably damaging Het
H2-M10.4 T A 17: 36,461,353 N168Y probably benign Het
Hpca C A 4: 129,118,494 R83L probably damaging Het
Igkv8-28 A G 6: 70,144,125 F13L probably benign Het
Il17ra A T 6: 120,481,504 I539F probably damaging Het
Kdm4a A G 4: 118,161,816 V401A possibly damaging Het
Krt86 A T 15: 101,477,276 T351S probably benign Het
Lig4 A G 8: 9,971,378 C801R probably benign Het
Lrrn4 G A 2: 132,872,091 P312S probably damaging Het
Macf1 T A 4: 123,474,848 H2040L probably benign Het
Madcam1 A G 10: 79,666,632 K317E possibly damaging Het
Maip1 T C 1: 57,411,802 I201T probably damaging Het
Map4k4 C A 1: 40,000,680 D513E probably benign Het
Mpped1 G A 15: 83,856,268 G137R probably damaging Het
Mrgprd T G 7: 145,322,186 F265V probably benign Het
Myct1 C T 10: 5,604,208 T25I probably damaging Het
Nbas C T 12: 13,432,922 S1400L possibly damaging Het
Nedd4 T A 9: 72,726,426 S405T probably benign Het
Neil2 A G 14: 63,191,778 V22A probably damaging Het
Nrip1 G C 16: 76,292,305 A788G probably benign Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr1344 G A 7: 6,439,021 probably benign Het
Olfr1535 T C 13: 21,555,999 I8V probably benign Het
Olfr456 T A 6: 42,486,896 Q99L probably damaging Het
Olfr479 A G 7: 108,055,953 T324A probably benign Het
Olfr811 C T 10: 129,802,353 M57I possibly damaging Het
Olfr961 C T 9: 39,647,200 T158I probably damaging Het
Orc2 T C 1: 58,466,062 N478S probably damaging Het
Oxct1 A G 15: 4,035,324 E48G possibly damaging Het
Pcca A G 14: 122,737,912 I28V probably benign Het
Pcdha8 T C 18: 36,993,188 V241A probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pkd2 T A 5: 104,483,224 W505R probably damaging Het
Plxnc1 C T 10: 94,910,586 V430I probably benign Het
Prkd3 A G 17: 78,971,454 M401T probably damaging Het
Rgmb A G 17: 15,807,486 C324R probably benign Het
Rsph6a A T 7: 19,065,439 probably benign Het
Sclt1 A T 3: 41,681,774 M264K probably benign Het
Serhl T A 15: 83,101,698 V30D possibly damaging Het
Sfrp1 T C 8: 23,412,143 V120A probably damaging Het
Slc22a8 C T 19: 8,609,666 Q408* probably null Het
Slc35b2 A G 17: 45,566,747 T218A probably damaging Het
Slco4c1 A T 1: 96,837,517 F403I probably damaging Het
Sorbs1 T A 19: 40,363,216 H250L probably damaging Het
Sorcs3 T A 19: 48,749,371 C742* probably null Het
Tmem8 T A 17: 26,120,400 S563T possibly damaging Het
Tnc T C 4: 64,000,733 Y1151C probably damaging Het
Tor1aip1 T A 1: 156,033,836 probably benign Het
Trim9 T C 12: 70,346,891 Q93R probably damaging Het
Tsnaxip1 A G 8: 105,844,181 Y613C probably damaging Het
Ttc6 C T 12: 57,728,410 Q1631* probably null Het
Ubr5 A G 15: 38,015,123 L881P probably damaging Het
Upp2 C T 2: 58,567,442 probably benign Het
Vmn1r203 T A 13: 22,524,834 S262T possibly damaging Het
Vmn2r116 A T 17: 23,386,762 D216V probably damaging Het
Vps52 A G 17: 33,958,075 Q96R probably benign Het
Other mutations in Mylk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Mylk APN 16 34938952 missense probably benign 0.36
IGL01386:Mylk APN 16 34971240 critical splice acceptor site probably null
IGL01684:Mylk APN 16 34971940 missense possibly damaging 0.55
IGL01884:Mylk APN 16 34988877 splice site probably benign
IGL02079:Mylk APN 16 34860631 missense possibly damaging 0.87
IGL02104:Mylk APN 16 34815435 missense probably benign 0.06
IGL02624:Mylk APN 16 34929896 missense probably benign 0.29
IGL02756:Mylk APN 16 34963646 missense probably benign 0.42
IGL02794:Mylk APN 16 34986541 missense probably benign 0.21
IGL02833:Mylk APN 16 34914900 missense probably benign 0.01
IGL02946:Mylk APN 16 34921788 missense probably benign 0.10
IGL03012:Mylk APN 16 34952781 missense probably benign 0.03
IGL03093:Mylk APN 16 34912192 missense possibly damaging 0.62
IGL03272:Mylk APN 16 34979189 missense probably benign 0.09
billy UTSW 16 34875620 missense probably damaging 0.97
brutus UTSW 16 34953695 missense probably benign 0.12
Club UTSW 16 34912275 nonsense probably null
popeye UTSW 16 34963577 missense probably benign 0.29
F5770:Mylk UTSW 16 34995204 critical splice donor site probably null
P4717OSA:Mylk UTSW 16 34977113 splice site probably benign
PIT4382001:Mylk UTSW 16 34875642 missense probably damaging 0.99
R0131:Mylk UTSW 16 34875504 missense probably benign 0.03
R0309:Mylk UTSW 16 34912297 splice site probably benign
R0358:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0381:Mylk UTSW 16 34784974 splice site probably null
R0390:Mylk UTSW 16 34875620 missense probably damaging 0.97
R0413:Mylk UTSW 16 34921944 missense probably benign 0.01
R0536:Mylk UTSW 16 35000387 missense possibly damaging 0.95
R0544:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0545:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0546:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0547:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0548:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0627:Mylk UTSW 16 35000429 missense probably damaging 1.00
R0726:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0755:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0782:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0783:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0784:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R1136:Mylk UTSW 16 35000318 missense probably damaging 1.00
R1170:Mylk UTSW 16 34874039 missense probably benign 0.20
R1222:Mylk UTSW 16 34860652 missense probably benign 0.12
R1445:Mylk UTSW 16 34815465 missense possibly damaging 0.57
R1583:Mylk UTSW 16 34875586 missense probably benign 0.29
R1618:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R1643:Mylk UTSW 16 34875635 missense probably benign 0.03
R1702:Mylk UTSW 16 34921944 missense probably benign 0.00
R1776:Mylk UTSW 16 34952782 missense probably benign 0.16
R1865:Mylk UTSW 16 34912230 missense probably benign 0.03
R1975:Mylk UTSW 16 34880303 splice site probably null
R2016:Mylk UTSW 16 34996817 missense probably damaging 1.00
R2045:Mylk UTSW 16 34953653 missense probably benign 0.29
R2134:Mylk UTSW 16 34986476 missense probably benign 0.13
R3547:Mylk UTSW 16 34880168 missense possibly damaging 0.61
R3844:Mylk UTSW 16 34921877 missense probably benign 0.01
R4003:Mylk UTSW 16 34963577 missense probably benign 0.29
R4396:Mylk UTSW 16 34912275 nonsense probably null
R4470:Mylk UTSW 16 34912152 missense probably benign 0.09
R4507:Mylk UTSW 16 34953695 missense probably benign 0.12
R4700:Mylk UTSW 16 34922435 missense probably benign 0.16
R4751:Mylk UTSW 16 34879169 missense probably benign 0.29
R4815:Mylk UTSW 16 34894925 missense probably damaging 0.97
R4832:Mylk UTSW 16 34922367 missense probably benign 0.36
R4872:Mylk UTSW 16 34914990 missense possibly damaging 0.89
R4953:Mylk UTSW 16 34988961 missense probably damaging 1.00
R4969:Mylk UTSW 16 34971440 missense probably damaging 0.96
R5009:Mylk UTSW 16 34899507 missense probably benign 0.39
R5130:Mylk UTSW 16 34988997 missense probably damaging 1.00
R5173:Mylk UTSW 16 34977013 missense probably benign 0.40
R5195:Mylk UTSW 16 34979215 missense probably damaging 1.00
R5209:Mylk UTSW 16 34922625 missense possibly damaging 0.55
R5311:Mylk UTSW 16 34921757 missense probably benign 0.01
R5418:Mylk UTSW 16 34912230 missense probably benign 0.02
R5481:Mylk UTSW 16 34921604 missense probably benign 0.09
R5590:Mylk UTSW 16 34879352 missense probably benign 0.29
R5603:Mylk UTSW 16 34956492 missense probably benign 0.06
R5823:Mylk UTSW 16 34894947 critical splice donor site probably null
R6290:Mylk UTSW 16 34894843 missense probably benign 0.39
R6351:Mylk UTSW 16 34921971 missense probably benign 0.01
R6365:Mylk UTSW 16 34860591 missense probably benign 0.12
R6490:Mylk UTSW 16 34929867 missense possibly damaging 0.74
R6723:Mylk UTSW 16 34929888 missense possibly damaging 0.74
R6864:Mylk UTSW 16 34874150 missense probably benign 0.03
R6908:Mylk UTSW 16 34880273 missense probably benign 0.18
R6949:Mylk UTSW 16 35000318 missense probably damaging 1.00
R7018:Mylk UTSW 16 35000426 missense possibly damaging 0.88
R7035:Mylk UTSW 16 34976982 missense possibly damaging 0.89
R7162:Mylk UTSW 16 34922529 missense probably damaging 1.00
R7236:Mylk UTSW 16 34922529 missense probably damaging 1.00
R7269:Mylk UTSW 16 34785011 missense probably damaging 0.96
R7475:Mylk UTSW 16 34914076 splice site probably null
R7525:Mylk UTSW 16 34988987 missense probably benign 0.06
R7587:Mylk UTSW 16 34922517 missense probably benign 0.29
R7607:Mylk UTSW 16 34894814 missense probably benign 0.09
R7616:Mylk UTSW 16 34879557 missense probably damaging 0.97
R7647:Mylk UTSW 16 34879524 missense probably benign 0.29
R7648:Mylk UTSW 16 34879524 missense probably benign 0.29
R7764:Mylk UTSW 16 34922183 missense probably benign 0.16
R7890:Mylk UTSW 16 34963648 nonsense probably null
R7892:Mylk UTSW 16 34879524 missense probably benign 0.29
R7893:Mylk UTSW 16 34879524 missense probably benign 0.29
R8065:Mylk UTSW 16 34972019 missense probably benign 0.08
R8067:Mylk UTSW 16 34972019 missense probably benign 0.08
R8143:Mylk UTSW 16 34914155 missense possibly damaging 0.87
R8210:Mylk UTSW 16 35000351 missense probably damaging 1.00
R8271:Mylk UTSW 16 34922579 missense probably damaging 0.97
R8540:Mylk UTSW 16 34929887 missense possibly damaging 0.87
R8721:Mylk UTSW 16 34996806 missense probably damaging 1.00
R8743:Mylk UTSW 16 34921057 missense probably benign 0.03
R8798:Mylk UTSW 16 34899402 missense possibly damaging 0.89
R9131:Mylk UTSW 16 34956465 missense probably benign 0.29
R9403:Mylk UTSW 16 34875642 nonsense probably null
R9624:Mylk UTSW 16 34879307 missense probably benign 0.29
R9735:Mylk UTSW 16 34914809 missense probably benign 0.09
R9756:Mylk UTSW 16 34914017 missense probably damaging 0.96
R9763:Mylk UTSW 16 34879112 nonsense probably null
RF001:Mylk UTSW 16 34879371 missense probably benign 0.03
V7580:Mylk UTSW 16 34995204 critical splice donor site probably null
V7583:Mylk UTSW 16 34995204 critical splice donor site probably null
X0065:Mylk UTSW 16 35000441 missense probably damaging 1.00
Z1177:Mylk UTSW 16 34922651 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TTGCTCTGGGTAGCCTTCAG -3'
(R):5'- AGACTCTTGGTTTTGGAAGAAGCG -3'

Sequencing Primer
(F):5'- GGGTAGCCTTCAGTACTAATCAC -3'
(R):5'- GCGGTGTCTGAGAGAACAC -3'
Posted On 2021-08-31