Mutagenetix > Incidental Mutation

Incidental Mutation 'R8957:Aff1'

682087

Institutional Source

Beutler Lab

Gene Symbol

Aff1

Ensembl Gene

ENSMUSG00000029313

Gene Name

AF4/FMR2 family, member 1

Synonyms

9630032B01Rik, Af4, Rob, Mllt2h

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.381) question?

Stock #

R8957 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103692374-103855322 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 103833768 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 591 (Q591R)

Ref Sequence

ENSEMBL: ENSMUSP00000059744 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031256] [ENSMUST00000054979] [ENSMUST00000153165]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031256
AA Change: Q599R

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000031256
Gene: ENSMUSG00000029313
AA Change: Q599R

Domain	Start	End	E-Value	Type
Pfam:AF-4	16	1223	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000054979
AA Change: Q591R

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000059744
Gene: ENSMUSG00000029313
AA Change: Q591R

Domain	Start	End	E-Value	Type
Pfam:AF-4	8	1216	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000153165
AA Change: Q599R

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000119631
Gene: ENSMUSG00000029313
AA Change: Q599R

Domain	Start	End	E-Value	Type
Pfam:AF-4	16	871	N/A	PFAM

Meta Mutation Damage Score

0.1367

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: This gene encodes a member of the AF4/ lymphoid nuclear protein related to AF4/Fragile X E mental retardation syndrome family of proteins, which have been implicated in human childhood lymphoblastic leukemia, Fragile X E site mental retardation, and ataxia. It is the prevalent mixed-lineage leukemia fusion gene associated with spontaneous acute lymphoblastic leukemia. Members of this family have three conserved domains: an N-terminal homology domain, an AF4/ lymphoid nuclear protein related to AF4/Fragile X E mental retardation syndrome domain, and a C-terminal homology domain. Knockout of the mouse gene by homologous recombination severely affects early events in lymphopoiesis, including precursor proliferation or recruitment, but is dispensable for terminal differentiation. In addition, an autosomal dominant missense mutation results in several phenotypes including ataxia and adult-onset Purkinje cell loss in the cerebellum, indicating a role in Purkinje cell maintenance and function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired B and T cell development. Heterozygotes for an ENU-induced mutation exhibit small size, ataxia, adult-onset Purkinje cell loss, cataracts, reduced survival, and low fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1500011B03Rik	A	G	5: 114,813,830	V28A	probably benign	Het
4932415D10Rik	A	G	10: 82,289,074	Y2701H	probably benign	Het
Abca12	T	A	1: 71,321,625	D503V	possibly damaging	Het
Aco2	A	T	15: 81,889,500		probably benign	Het
Ankle2	G	A	5: 110,231,255	A7T	possibly damaging	Het
Ankrd12	T	C	17: 65,984,496	N1314S	probably benign	Het
Apeh	A	T	9: 108,092,373	M216K	probably benign	Het
Armh1	T	C	4: 117,229,907	Y187C	probably damaging	Het
Ascc3	C	A	10: 50,700,112	A821E	probably damaging	Het
Atf7ip	A	G	6: 136,566,703	D650G	probably null	Het
BC055324	C	T	1: 163,964,766	R554H	probably damaging	Het
Cav1	T	A	6: 17,339,236	F107I	probably benign	Het
Ccdc146	A	G	5: 21,309,587		probably benign	Het
Ccdc57	A	G	11: 120,886,035	I513T	probably benign	Het
Ccrl2	T	C	9: 111,055,489	R314G	probably benign	Het
Cd1d1	T	C	3: 86,998,833	D45G	probably damaging	Het
Cfap74	G	A	4: 155,436,730	E620K		Het
Col4a1	T	A	8: 11,245,906		probably benign	Het
Cux2	C	T	5: 121,860,948	G1310R	probably benign	Het
Cyld	G	T	8: 88,705,782	R136L	probably damaging	Het
Cyp4v3	A	T	8: 45,306,981	N511K	probably benign	Het
Dchs2	G	A	3: 83,282,266	V1646M		Het
Des	A	T	1: 75,363,651	I401F	probably damaging	Het
Dis3	T	C	14: 99,099,591	D28G	probably damaging	Het
Ehd1	A	G	19: 6,294,409	Y233C	probably damaging	Het
Fcrlb	G	A	1: 170,907,967	A246V	probably benign	Het
Fnta	T	C	8: 25,999,513	R357G	probably benign	Het
Fpgs	T	C	2: 32,685,342	D420G	probably damaging	Het
Hdac4	T	C	1: 91,946,035		probably null	Het
Hdhd5	C	T	6: 120,518,443		probably null	Het
Iqgap2	G	A	13: 95,635,646	R1342C	probably damaging	Het
Isyna1	T	G	8: 70,596,722	L428R	probably damaging	Het
Jmjd4	C	T	11: 59,450,058		probably benign	Het
Klra1	A	G	6: 130,380,646	V6A	possibly damaging	Het
Klrb1b	T	A	6: 128,818,559	K124N	probably benign	Het
Krtap19-3	T	C	16: 88,877,945		probably benign	Het
Lrrc74b	T	C	16: 17,561,112	T34A	probably benign	Het
Map9	A	G	3: 82,371,380	Y229C	probably benign	Het
Mmp28	T	C	11: 83,443,810	I373V	possibly damaging	Het
Mpdz	A	T	4: 81,332,979	Y1086*	probably null	Het
Myct1	C	T	10: 5,604,208	T25I	probably damaging	Het
Myh4	A	G	11: 67,250,954	K880E	possibly damaging	Het
Nav2	T	G	7: 49,571,216	V1656G	probably damaging	Het
Olfr103	A	G	17: 37,336,491	V247A	probably damaging	Het
Olfr1453	T	A	19: 13,027,517	I271F	probably benign	Het
Olfr403	T	A	11: 74,195,946	S148T	probably damaging	Het
Pate2	T	C	9: 35,685,615	W100R	probably benign	Het
Pcdhb11	A	C	18: 37,421,639	K7N	probably benign	Het
Pcdhb11	A	G	18: 37,422,819	T401A	probably benign	Het
Pgam1	T	A	19: 41,916,776	I183N	possibly damaging	Het
Pou5f1	T	G	17: 35,510,469	L326R	possibly damaging	Het
Rbm34	A	C	8: 126,965,458	V178G	probably benign	Het
Rc3h2	A	G	2: 37,399,648	V384A	possibly damaging	Het
Sec62	T	A	3: 30,810,522	F178L	unknown	Het
Slco1a6	T	C	6: 142,145,767	N69S	probably damaging	Het
Smok2b	T	A	17: 13,234,986	L11Q	probably damaging	Het
Snai2	T	C	16: 14,708,249	S255P	probably damaging	Het
Tesk2	T	A	4: 116,802,713	F343I	probably benign	Het
Tmem106c	A	T	15: 97,969,600	I222F	probably benign	Het
Tmub1	G	T	5: 24,446,777	T63K	probably benign	Het
Tnip3	A	G	6: 65,605,859	T217A	probably benign	Het
Vmn2r10	T	G	5: 109,001,914	K421N	possibly damaging	Het
Wdr78	T	C	4: 103,096,753	D83G	probably damaging	Het
Zfp975	A	T	7: 42,661,733	H485Q	probably damaging	Het

Other mutations in Aff1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00773:Aff1	APN	5	103784077	missense	probably damaging	1.00
IGL02060:Aff1	APN	5	103783849	missense	possibly damaging	0.51
IGL02081:Aff1	APN	5	103834305	missense	probably damaging	1.00
IGL02108:Aff1	APN	5	103811109	critical splice donor site	probably null
IGL03056:Aff1	APN	5	103811081	missense	probably damaging	0.99
IGL03332:Aff1	APN	5	103841105	nonsense	probably null
IGL03340:Aff1	APN	5	103783804	missense	possibly damaging	0.76
IGL03382:Aff1	APN	5	103841060	missense	possibly damaging	0.86
PIT4495001:Aff1	UTSW	5	103849525	missense	probably benign	0.16
R0013:Aff1	UTSW	5	103828484	nonsense	probably null
R0219:Aff1	UTSW	5	103811040	splice site	probably benign
R0520:Aff1	UTSW	5	103847751	nonsense	probably null
R0607:Aff1	UTSW	5	103828454	missense	probably damaging	1.00
R0883:Aff1	UTSW	5	103826138	splice site	probably benign
R1662:Aff1	UTSW	5	103841057	missense	probably damaging	0.99
R1730:Aff1	UTSW	5	103833512	missense	probably damaging	1.00
R1850:Aff1	UTSW	5	103833907	missense	probably damaging	1.00
R3411:Aff1	UTSW	5	103754706	start codon destroyed	probably null	0.53
R4007:Aff1	UTSW	5	103784222	missense	probably benign	0.15
R4207:Aff1	UTSW	5	103818988	critical splice donor site	probably null
R4702:Aff1	UTSW	5	103811069	missense	probably damaging	1.00
R4730:Aff1	UTSW	5	103843073	missense	possibly damaging	0.95
R4784:Aff1	UTSW	5	103847039	nonsense	probably null
R5166:Aff1	UTSW	5	103754657	start gained	probably benign
R5294:Aff1	UTSW	5	103811157	intron	probably benign
R5435:Aff1	UTSW	5	103754332	unclassified	probably benign
R5436:Aff1	UTSW	5	103783870	missense	probably damaging	1.00
R6065:Aff1	UTSW	5	103842252	missense	probably damaging	1.00
R6114:Aff1	UTSW	5	103842297	missense	probably damaging	0.97
R6298:Aff1	UTSW	5	103754720	missense	possibly damaging	0.68
R7095:Aff1	UTSW	5	103843085	missense	probably damaging	0.97
R7261:Aff1	UTSW	5	103828379	missense	probably damaging	0.97
R7350:Aff1	UTSW	5	103847092	missense	probably benign	0.28
R7423:Aff1	UTSW	5	103847101	missense	probably damaging	1.00
R7469:Aff1	UTSW	5	103833547	missense	probably benign	0.00
R7604:Aff1	UTSW	5	103847809	missense	probably benign	0.09
R7607:Aff1	UTSW	5	103849459	missense	possibly damaging	0.72
R8014:Aff1	UTSW	5	103833869	missense	possibly damaging	0.82
R8219:Aff1	UTSW	5	103846333	missense	probably damaging	1.00
R8315:Aff1	UTSW	5	103811090	missense	probably damaging	0.99
R8837:Aff1	UTSW	5	103834212	missense	possibly damaging	0.77
R9159:Aff1	UTSW	5	103842265	missense	possibly damaging	0.89
R9377:Aff1	UTSW	5	103833819	missense	probably damaging	0.96
R9381:Aff1	UTSW	5	103833867	missense	possibly damaging	0.85
R9705:Aff1	UTSW	5	103784410	missense	possibly damaging	0.88
R9725:Aff1	UTSW	5	103847065	missense	probably damaging	0.99
R9764:Aff1	UTSW	5	103849499	missense	probably damaging	1.00
Z1177:Aff1	UTSW	5	103783753	missense	possibly damaging	0.71

Predicted Primers

PCR Primer
(F):5'- AGAGTCTCCACAATGGCGC -3'
(R):5'- CGTGGAGCTCTTGTGCTTCC -3'

Sequencing Primer
(F):5'- CCACAATGGCGCCAGGAAAG -3'
(R):5'- AGGGACCTCTGGCTTAGG -3'

Posted On

2021-08-31