Incidental Mutation 'R8957:Cyp4v3'
ID 682103
Institutional Source Beutler Lab
Gene Symbol Cyp4v3
Ensembl Gene ENSMUSG00000079057
Gene Name cytochrome P450, family 4, subfamily v, polypeptide 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8957 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 45304944-45333216 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 45306981 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 511 (N511K)
Ref Sequence ENSEMBL: ENSMUSP00000092966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095328]
AlphaFold Q9DBW0
Predicted Effect probably benign
Transcript: ENSMUST00000095328
AA Change: N511K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000092966
Gene: ENSMUSG00000079057
AA Change: N511K

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 51 517 2.7e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116473
AA Change: N71K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112174
Gene: ENSMUSG00000031640
AA Change: N71K

DomainStartEndE-ValueType
APPLE 21 104 1.96e-40 SMART
APPLE 111 194 3.93e-40 SMART
APPLE 201 284 2.65e-37 SMART
APPLE 292 375 1.34e-33 SMART
Tryp_SPc 390 621 2.22e-99 SMART
Meta Mutation Damage Score 0.1602 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 hemethiolate protein superfamily which are involved in oxidizing various substrates in the metabolic pathway. It is implicated in the metabolism of fatty acid precursors into n-3 polyunsaturated fatty acids. Mutations in this gene result in Bietti crystalline corneoretinal dystrophy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit corneoretinal crystal accumulation and systemic dyslipidemia characteristic of Bietti Crystalline Dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500011B03Rik A G 5: 114,813,830 V28A probably benign Het
4932415D10Rik A G 10: 82,289,074 Y2701H probably benign Het
Abca12 T A 1: 71,321,625 D503V possibly damaging Het
Aco2 A T 15: 81,889,500 probably benign Het
Aff1 A G 5: 103,833,768 Q591R possibly damaging Het
Ankle2 G A 5: 110,231,255 A7T possibly damaging Het
Ankrd12 T C 17: 65,984,496 N1314S probably benign Het
Apeh A T 9: 108,092,373 M216K probably benign Het
Armh1 T C 4: 117,229,907 Y187C probably damaging Het
Ascc3 C A 10: 50,700,112 A821E probably damaging Het
Atf7ip A G 6: 136,566,703 D650G probably null Het
BC055324 C T 1: 163,964,766 R554H probably damaging Het
Cav1 T A 6: 17,339,236 F107I probably benign Het
Ccdc146 A G 5: 21,309,587 probably benign Het
Ccdc57 A G 11: 120,886,035 I513T probably benign Het
Ccrl2 T C 9: 111,055,489 R314G probably benign Het
Cd1d1 T C 3: 86,998,833 D45G probably damaging Het
Cfap74 G A 4: 155,436,730 E620K Het
Col4a1 T A 8: 11,245,906 probably benign Het
Cux2 C T 5: 121,860,948 G1310R probably benign Het
Cyld G T 8: 88,705,782 R136L probably damaging Het
Dchs2 G A 3: 83,282,266 V1646M Het
Des A T 1: 75,363,651 I401F probably damaging Het
Dis3 T C 14: 99,099,591 D28G probably damaging Het
Ehd1 A G 19: 6,294,409 Y233C probably damaging Het
Fcrlb G A 1: 170,907,967 A246V probably benign Het
Fnta T C 8: 25,999,513 R357G probably benign Het
Fpgs T C 2: 32,685,342 D420G probably damaging Het
Hdac4 T C 1: 91,946,035 probably null Het
Hdhd5 C T 6: 120,518,443 probably null Het
Iqgap2 G A 13: 95,635,646 R1342C probably damaging Het
Isyna1 T G 8: 70,596,722 L428R probably damaging Het
Jmjd4 C T 11: 59,450,058 probably benign Het
Klra1 A G 6: 130,380,646 V6A possibly damaging Het
Klrb1b T A 6: 128,818,559 K124N probably benign Het
Krtap19-3 T C 16: 88,877,945 probably benign Het
Lrrc74b T C 16: 17,561,112 T34A probably benign Het
Map9 A G 3: 82,371,380 Y229C probably benign Het
Mmp28 T C 11: 83,443,810 I373V possibly damaging Het
Mpdz A T 4: 81,332,979 Y1086* probably null Het
Myct1 C T 10: 5,604,208 T25I probably damaging Het
Myh4 A G 11: 67,250,954 K880E possibly damaging Het
Nav2 T G 7: 49,571,216 V1656G probably damaging Het
Olfr103 A G 17: 37,336,491 V247A probably damaging Het
Olfr1453 T A 19: 13,027,517 I271F probably benign Het
Olfr403 T A 11: 74,195,946 S148T probably damaging Het
Pate2 T C 9: 35,685,615 W100R probably benign Het
Pcdhb11 A C 18: 37,421,639 K7N probably benign Het
Pcdhb11 A G 18: 37,422,819 T401A probably benign Het
Pgam1 T A 19: 41,916,776 I183N possibly damaging Het
Pou5f1 T G 17: 35,510,469 L326R possibly damaging Het
Rbm34 A C 8: 126,965,458 V178G probably benign Het
Rc3h2 A G 2: 37,399,648 V384A possibly damaging Het
Sec62 T A 3: 30,810,522 F178L unknown Het
Slco1a6 T C 6: 142,145,767 N69S probably damaging Het
Smok2b T A 17: 13,234,986 L11Q probably damaging Het
Snai2 T C 16: 14,708,249 S255P probably damaging Het
Tesk2 T A 4: 116,802,713 F343I probably benign Het
Tmem106c A T 15: 97,969,600 I222F probably benign Het
Tmub1 G T 5: 24,446,777 T63K probably benign Het
Tnip3 A G 6: 65,605,859 T217A probably benign Het
Vmn2r10 T G 5: 109,001,914 K421N possibly damaging Het
Wdr78 T C 4: 103,096,753 D83G probably damaging Het
Zfp975 A T 7: 42,661,733 H485Q probably damaging Het
Other mutations in Cyp4v3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Cyp4v3 APN 8 45307003 missense probably benign 0.04
IGL00503:Cyp4v3 APN 8 45307021 missense probably damaging 0.98
IGL00757:Cyp4v3 APN 8 45320615 missense probably damaging 0.98
IGL02375:Cyp4v3 APN 8 45308374 splice site probably null
IGL02565:Cyp4v3 APN 8 45320637 missense possibly damaging 0.63
IGL02881:Cyp4v3 APN 8 45308716 missense probably damaging 1.00
R0745:Cyp4v3 UTSW 8 45308651 unclassified probably benign
R1818:Cyp4v3 UTSW 8 45315636 missense possibly damaging 0.77
R1819:Cyp4v3 UTSW 8 45315636 missense possibly damaging 0.77
R1902:Cyp4v3 UTSW 8 45306952 missense probably benign 0.00
R2426:Cyp4v3 UTSW 8 45317776 missense probably benign
R3747:Cyp4v3 UTSW 8 45315708 nonsense probably null
R3748:Cyp4v3 UTSW 8 45315708 nonsense probably null
R3750:Cyp4v3 UTSW 8 45315708 nonsense probably null
R4289:Cyp4v3 UTSW 8 45328223 missense possibly damaging 0.46
R4569:Cyp4v3 UTSW 8 45306992 missense probably damaging 1.00
R4960:Cyp4v3 UTSW 8 45320637 missense possibly damaging 0.63
R5260:Cyp4v3 UTSW 8 45306980 missense probably damaging 1.00
R5479:Cyp4v3 UTSW 8 45310206 missense probably benign 0.00
R5667:Cyp4v3 UTSW 8 45308535 missense possibly damaging 0.94
R5940:Cyp4v3 UTSW 8 45321784 missense probably damaging 1.00
R6102:Cyp4v3 UTSW 8 45320160 missense probably damaging 1.00
R6470:Cyp4v3 UTSW 8 45317736 nonsense probably null
R6592:Cyp4v3 UTSW 8 45306981 missense probably benign 0.02
R6700:Cyp4v3 UTSW 8 45307093 missense probably damaging 1.00
R7027:Cyp4v3 UTSW 8 45310252 missense possibly damaging 0.93
R7341:Cyp4v3 UTSW 8 45321750 missense probably benign 0.01
R7966:Cyp4v3 UTSW 8 45332917 missense probably benign 0.44
R8331:Cyp4v3 UTSW 8 45315708 nonsense probably null
R8886:Cyp4v3 UTSW 8 45321748 nonsense probably null
R8955:Cyp4v3 UTSW 8 45308527 missense probably benign 0.00
R9718:Cyp4v3 UTSW 8 45320666 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTGTGTCCCAAGATCTGG -3'
(R):5'- TACGTGGATGTGAAGTGCC -3'

Sequencing Primer
(F):5'- CCAAGATCTGGGGTGCAG -3'
(R):5'- TGCAGCTTCGGTATCTCATG -3'
Posted On 2021-08-31