Incidental Mutation 'R8958:Ism1'
ID 682142
Institutional Source Beutler Lab
Gene Symbol Ism1
Ensembl Gene ENSMUSG00000074766
Gene Name isthmin 1, angiogenesis inhibitor
Synonyms 5430433G21Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.680) question?
Stock # R8958 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 139678178-139758581 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 139732075 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 115 (I115N)
Ref Sequence ENSEMBL: ENSMUSP00000139280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099307] [ENSMUST00000184404]
AlphaFold A2ATD1
Predicted Effect
SMART Domains Protein: ENSMUSP00000096910
Gene: ENSMUSG00000074766
AA Change: I108N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 165 177 N/A INTRINSIC
TSP1 210 252 3.69e-8 SMART
AMOP 279 442 5.38e-91 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000184404
AA Change: I115N

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139280
Gene: ENSMUSG00000074766
AA Change: I115N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 172 184 N/A INTRINSIC
TSP1 217 259 3.69e-8 SMART
AMOP 286 449 5.38e-91 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 A T 12: 21,349,933 N157K possibly damaging Het
Adck2 T C 6: 39,583,914 V412A probably benign Het
Adgrb3 C T 1: 25,826,109 V11I possibly damaging Het
Arhgef17 T C 7: 100,929,812 D643G probably damaging Het
Arvcf A G 16: 18,402,626 Q597R probably damaging Het
Brdt T C 5: 107,378,011 V910A probably benign Het
Cachd1 A G 4: 100,994,086 D1167G probably benign Het
Ccdc187 A C 2: 26,275,565 S860A probably benign Het
Ccdc28a T C 10: 18,214,178 I113M probably benign Het
Cdc5l T C 17: 45,393,201 N699S probably benign Het
Cenpf A T 1: 189,653,153 I2310K possibly damaging Het
Ch25h A T 19: 34,475,014 I38N probably benign Het
Chrdl2 C A 7: 100,020,922 P84Q probably damaging Het
Cltc A T 11: 86,695,577 Y1673N possibly damaging Het
Cr1l C G 1: 195,129,935 G27R probably damaging Het
Crebbp G A 16: 4,213,308 probably benign Het
Dync1h1 G A 12: 110,620,371 E929K probably benign Het
E2f7 C A 10: 110,765,754 P324Q probably damaging Het
Eif3b A G 5: 140,425,439 D215G probably benign Het
Ephb1 A G 9: 102,195,415 I55T probably damaging Het
Fam126a A G 5: 23,964,936 C472R probably benign Het
Fbxw14 A T 9: 109,278,742 L188Q probably damaging Het
Foxg1 T C 12: 49,385,161 S226P probably damaging Het
Gbe1 T C 16: 70,478,322 F337L probably damaging Het
Glg1 A T 8: 111,172,484 C716* probably null Het
Gm35339 A T 15: 76,361,494 E1310D Het
Gp1ba C G 11: 70,640,904 probably benign Het
Grm7 C T 6: 111,495,822 S36L probably damaging Het
H2-M5 T A 17: 36,988,628 I167F probably damaging Het
Hist1h3e T C 13: 23,562,247 H40R possibly damaging Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Ino80 C T 2: 119,383,381 R1236H probably damaging Het
Kdm4a A G 4: 118,142,376 S950P probably benign Het
Lama5 T C 2: 180,193,799 T1254A probably benign Het
Lipo2 T A 19: 33,720,961 K339* probably null Het
Lrrc7 T C 3: 158,240,501 K187R probably benign Het
Mkrn2os G C 6: 115,585,356 S215R probably benign Het
Myzap G T 9: 71,550,203 D303E possibly damaging Het
Naa11 T C 5: 97,392,225 N25D probably damaging Het
Naip5 T A 13: 100,217,609 K1149* probably null Het
Obscn C T 11: 59,073,332 V3083M probably damaging Het
Olfr1298 T C 2: 111,645,725 T91A possibly damaging Het
Olfr959 T C 9: 39,572,795 T155A probably benign Het
Parn T A 16: 13,648,458 E241D possibly damaging Het
Pax1 T A 2: 147,368,597 probably null Het
Pclo A T 5: 14,675,355 E1409V unknown Het
Pclo A G 5: 14,713,042 Y3843C unknown Het
Ppp2r3a A T 9: 101,211,435 M563K probably benign Het
Prdm1 T G 10: 44,440,733 K623Q probably damaging Het
Ptpn13 T C 5: 103,551,107 V1152A probably benign Het
Ptx3 G A 3: 66,220,970 A151T probably benign Het
Rab11fip1 T C 8: 27,154,912 S282G possibly damaging Het
Ros1 G T 10: 52,096,094 N1641K probably damaging Het
Syne1 T C 10: 5,231,768 K4189R probably benign Het
Tcf3 T C 10: 80,410,257 K611E probably damaging Het
Tmem215 A G 4: 40,474,376 Q151R probably benign Het
Trappc8 T C 18: 20,870,610 I254V probably benign Het
Trim46 T C 3: 89,236,453 D556G probably damaging Het
Zfp513 C A 5: 31,199,481 R487L probably damaging Het
Zmpste24 C A 4: 121,087,311 E97* probably null Het
Other mutations in Ism1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Ism1 APN 2 139757303 missense probably damaging 1.00
IGL02496:Ism1 APN 2 139757201 missense probably damaging 1.00
IGL03349:Ism1 APN 2 139731975 nonsense probably null
R0212:Ism1 UTSW 2 139740257 missense probably benign 0.00
R0312:Ism1 UTSW 2 139678672 start codon destroyed probably null 0.88
R1355:Ism1 UTSW 2 139732074 missense possibly damaging 0.93
R1370:Ism1 UTSW 2 139732074 missense possibly damaging 0.93
R1775:Ism1 UTSW 2 139746043 missense probably damaging 1.00
R1992:Ism1 UTSW 2 139746017 missense probably benign 0.01
R2021:Ism1 UTSW 2 139740127 splice site probably null
R2035:Ism1 UTSW 2 139757155 missense probably damaging 1.00
R2270:Ism1 UTSW 2 139757373 missense probably damaging 1.00
R2271:Ism1 UTSW 2 139757373 missense probably damaging 1.00
R3722:Ism1 UTSW 2 139732011 nonsense probably null
R3792:Ism1 UTSW 2 139740253 missense probably damaging 0.99
R4907:Ism1 UTSW 2 139678752 missense probably benign 0.27
R5621:Ism1 UTSW 2 139678721 missense probably damaging 0.99
R5964:Ism1 UTSW 2 139678757 missense probably benign
R6255:Ism1 UTSW 2 139746042 small deletion probably benign
R7009:Ism1 UTSW 2 139757279 missense probably damaging 1.00
R7325:Ism1 UTSW 2 139757043 missense probably damaging 1.00
R7851:Ism1 UTSW 2 139757265 missense probably damaging 1.00
R8851:Ism1 UTSW 2 139749545 missense probably damaging 1.00
R9365:Ism1 UTSW 2 139740401 missense probably damaging 1.00
Z1176:Ism1 UTSW 2 139731874 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCAGCTTTCCTCTGTCCAAAG -3'
(R):5'- AATCGCTGCAATTTCAGGGTG -3'

Sequencing Primer
(F):5'- TGTCCAAAGAAGCCCCGGAG -3'
(R):5'- CTCAGTGTCTCAAAAATAATGGTGGG -3'
Posted On 2021-08-31