Incidental Mutation 'R8958:Brdt'
ID 682158
Institutional Source Beutler Lab
Gene Symbol Brdt
Ensembl Gene ENSMUSG00000029279
Gene Name bromodomain, testis-specific
Synonyms Fsrg3, 7420412D09Rik, Brd6
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8958 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 107331159-107387058 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 107378011 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 910 (V910A)
Ref Sequence ENSEMBL: ENSMUSP00000031215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031215]
AlphaFold Q91Y44
PDB Structure Structure of Brdt bromodomain 2 bound to an acetylated histone H3 peptide [X-RAY DIFFRACTION]
Structure of Brdt bromodomain BD1 bound to a diacetylated histone H4 peptide. [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000031215
AA Change: V910A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031215
Gene: ENSMUSG00000029279
AA Change: V910A

DomainStartEndE-ValueType
BROMO 24 134 2.7e-45 SMART
BROMO 268 377 2.18e-40 SMART
low complexity region 392 417 N/A INTRINSIC
low complexity region 446 455 N/A INTRINSIC
low complexity region 472 500 N/A INTRINSIC
Pfam:BET 505 569 9.2e-34 PFAM
low complexity region 585 603 N/A INTRINSIC
low complexity region 649 691 N/A INTRINSIC
low complexity region 895 909 N/A INTRINSIC
Pfam:BRD4_CDT 913 956 3e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the BET protein family. BET proteins have two N-terminal bromodomains and one C-terminal extraterminal domain (ET domain). BET proteins regulate chromatin reorganization via binding to acetylated histones. This gene is thought to play a role in the transcriptional regulation of spermatogenesis. Although referred to as testis-specific bromodomain (Brdt) protein, RT-PCR indicates that this gene is expressed in both mouse oocytes and testes. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this genes leads to arrest of spermatogenesis and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 A T 12: 21,349,933 N157K possibly damaging Het
Adck2 T C 6: 39,583,914 V412A probably benign Het
Adgrb3 C T 1: 25,826,109 V11I possibly damaging Het
Arhgef17 T C 7: 100,929,812 D643G probably damaging Het
Arvcf A G 16: 18,402,626 Q597R probably damaging Het
Cachd1 A G 4: 100,994,086 D1167G probably benign Het
Ccdc187 A C 2: 26,275,565 S860A probably benign Het
Ccdc28a T C 10: 18,214,178 I113M probably benign Het
Cdc5l T C 17: 45,393,201 N699S probably benign Het
Cenpf A T 1: 189,653,153 I2310K possibly damaging Het
Ch25h A T 19: 34,475,014 I38N probably benign Het
Chrdl2 C A 7: 100,020,922 P84Q probably damaging Het
Cltc A T 11: 86,695,577 Y1673N possibly damaging Het
Cr1l C G 1: 195,129,935 G27R probably damaging Het
Crebbp G A 16: 4,213,308 probably benign Het
Dync1h1 G A 12: 110,620,371 E929K probably benign Het
E2f7 C A 10: 110,765,754 P324Q probably damaging Het
Eif3b A G 5: 140,425,439 D215G probably benign Het
Ephb1 A G 9: 102,195,415 I55T probably damaging Het
Fam126a A G 5: 23,964,936 C472R probably benign Het
Fbxw14 A T 9: 109,278,742 L188Q probably damaging Het
Foxg1 T C 12: 49,385,161 S226P probably damaging Het
Gbe1 T C 16: 70,478,322 F337L probably damaging Het
Glg1 A T 8: 111,172,484 C716* probably null Het
Gm35339 A T 15: 76,361,494 E1310D Het
Gp1ba C G 11: 70,640,904 probably benign Het
Grm7 C T 6: 111,495,822 S36L probably damaging Het
H2-M5 T A 17: 36,988,628 I167F probably damaging Het
Hist1h3e T C 13: 23,562,247 H40R possibly damaging Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Ino80 C T 2: 119,383,381 R1236H probably damaging Het
Ism1 T A 2: 139,732,075 I115N possibly damaging Het
Kdm4a A G 4: 118,142,376 S950P probably benign Het
Lama5 T C 2: 180,193,799 T1254A probably benign Het
Lipo2 T A 19: 33,720,961 K339* probably null Het
Lrrc7 T C 3: 158,240,501 K187R probably benign Het
Mkrn2os G C 6: 115,585,356 S215R probably benign Het
Myzap G T 9: 71,550,203 D303E possibly damaging Het
Naa11 T C 5: 97,392,225 N25D probably damaging Het
Naip5 T A 13: 100,217,609 K1149* probably null Het
Obscn C T 11: 59,073,332 V3083M probably damaging Het
Olfr1298 T C 2: 111,645,725 T91A possibly damaging Het
Olfr959 T C 9: 39,572,795 T155A probably benign Het
Parn T A 16: 13,648,458 E241D possibly damaging Het
Pax1 T A 2: 147,368,597 probably null Het
Pclo A T 5: 14,675,355 E1409V unknown Het
Pclo A G 5: 14,713,042 Y3843C unknown Het
Ppp2r3a A T 9: 101,211,435 M563K probably benign Het
Prdm1 T G 10: 44,440,733 K623Q probably damaging Het
Ptpn13 T C 5: 103,551,107 V1152A probably benign Het
Ptx3 G A 3: 66,220,970 A151T probably benign Het
Rab11fip1 T C 8: 27,154,912 S282G possibly damaging Het
Ros1 G T 10: 52,096,094 N1641K probably damaging Het
Syne1 T C 10: 5,231,768 K4189R probably benign Het
Tcf3 T C 10: 80,410,257 K611E probably damaging Het
Tmem215 A G 4: 40,474,376 Q151R probably benign Het
Trappc8 T C 18: 20,870,610 I254V probably benign Het
Trim46 T C 3: 89,236,453 D556G probably damaging Het
Zfp513 C A 5: 31,199,481 R487L probably damaging Het
Zmpste24 C A 4: 121,087,311 E97* probably null Het
Other mutations in Brdt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02342:Brdt APN 5 107342203 missense probably damaging 1.00
IGL02718:Brdt APN 5 107350068 splice site probably benign
IGL02746:Brdt APN 5 107370324 missense probably benign
IGL02851:Brdt APN 5 107377995 missense possibly damaging 0.47
R0585:Brdt UTSW 5 107356882 critical splice donor site probably null
R0708:Brdt UTSW 5 107358900 nonsense probably null
R1338:Brdt UTSW 5 107350188 missense probably benign 0.02
R1710:Brdt UTSW 5 107343584 missense probably damaging 1.00
R1794:Brdt UTSW 5 107359853 small deletion probably benign
R1861:Brdt UTSW 5 107359458 missense probably benign
R1913:Brdt UTSW 5 107348613 missense probably benign
R2029:Brdt UTSW 5 107359224 missense probably benign 0.35
R2431:Brdt UTSW 5 107378015 splice site probably null
R3121:Brdt UTSW 5 107377145 missense probably damaging 0.99
R3122:Brdt UTSW 5 107377145 missense probably damaging 0.99
R4258:Brdt UTSW 5 107359909 missense probably damaging 0.97
R4609:Brdt UTSW 5 107359936 missense probably benign 0.00
R5306:Brdt UTSW 5 107345144 missense probably damaging 1.00
R5640:Brdt UTSW 5 107359308 nonsense probably null
R5677:Brdt UTSW 5 107348617 missense possibly damaging 0.85
R5936:Brdt UTSW 5 107359395 missense probably damaging 1.00
R6145:Brdt UTSW 5 107377999 missense possibly damaging 0.67
R6261:Brdt UTSW 5 107348503 missense probably benign 0.04
R6408:Brdt UTSW 5 107385492 missense probably damaging 1.00
R6930:Brdt UTSW 5 107359215 missense probably benign 0.35
R7372:Brdt UTSW 5 107370294 missense possibly damaging 0.49
R7741:Brdt UTSW 5 107358886 missense probably benign 0.00
R7842:Brdt UTSW 5 107348588 missense possibly damaging 0.49
R7869:Brdt UTSW 5 107370179 missense probably benign 0.04
R7887:Brdt UTSW 5 107359933 missense possibly damaging 0.66
R7972:Brdt UTSW 5 107348549 missense possibly damaging 0.53
R8064:Brdt UTSW 5 107377996 nonsense probably null
R9199:Brdt UTSW 5 107350163 nonsense probably null
R9346:Brdt UTSW 5 107377014 missense probably damaging 0.99
X0011:Brdt UTSW 5 107342128 missense probably damaging 0.96
X0011:Brdt UTSW 5 107377092 missense probably damaging 1.00
Z1176:Brdt UTSW 5 107359898 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- CCAGGACATGGCTTTCTGTAG -3'
(R):5'- AGTGATTGCCCCACTCACAC -3'

Sequencing Primer
(F):5'- ACATGGCTTTCTGTAGTTGTTTAATC -3'
(R):5'- CAGTCTAATGGTCCCACAGTGTG -3'
Posted On 2021-08-31