Mutagenetix > Incidental Mutations

Incidental Mutation 'R8958:Brdt'

682158

Institutional Source

Beutler Lab

Gene Symbol

Brdt

Ensembl Gene

ENSMUSG00000029279

Gene Name

bromodomain, testis-specific

Synonyms

Fsrg3, 7420412D09Rik, Brd6

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8958 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

107331159-107387058 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 107378011 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 910 (V910A)

Ref Sequence

ENSEMBL: ENSMUSP00000031215 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031215]

AlphaFold

Q91Y44

PDB Structure

Structure of Brdt bromodomain 2 bound to an acetylated histone H3 peptide [X-RAY DIFFRACTION]
Structure of Brdt bromodomain BD1 bound to a diacetylated histone H4 peptide. [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000031215
AA Change: V910A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000031215
Gene: ENSMUSG00000029279
AA Change: V910A

Domain	Start	End	E-Value	Type
BROMO	24	134	2.7e-45	SMART
BROMO	268	377	2.18e-40	SMART
low complexity region	392	417	N/A	INTRINSIC
low complexity region	446	455	N/A	INTRINSIC
low complexity region	472	500	N/A	INTRINSIC
Pfam:BET	505	569	9.2e-34	PFAM
low complexity region	585	603	N/A	INTRINSIC
low complexity region	649	691	N/A	INTRINSIC
low complexity region	895	909	N/A	INTRINSIC
Pfam:BRD4_CDT	913	956	3e-26	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.8%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene belongs to the BET protein family. BET proteins have two N-terminal bromodomains and one C-terminal extraterminal domain (ET domain). BET proteins regulate chromatin reorganization via binding to acetylated histones. This gene is thought to play a role in the transcriptional regulation of spermatogenesis. Although referred to as testis-specific bromodomain (Brdt) protein, RT-PCR indicates that this gene is expressed in both mouse oocytes and testes. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this genes leads to arrest of spermatogenesis and male infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam17	A	T	12: 21,349,933	N157K	possibly damaging	Het
Adck2	T	C	6: 39,583,914	V412A	probably benign	Het
Adgrb3	C	T	1: 25,826,109	V11I	possibly damaging	Het
Arhgef17	T	C	7: 100,929,812	D643G	probably damaging	Het
Arvcf	A	G	16: 18,402,626	Q597R	probably damaging	Het
Cachd1	A	G	4: 100,994,086	D1167G	probably benign	Het
Ccdc187	A	C	2: 26,275,565	S860A	probably benign	Het
Ccdc28a	T	C	10: 18,214,178	I113M	probably benign	Het
Cdc5l	T	C	17: 45,393,201	N699S	probably benign	Het
Cenpf	A	T	1: 189,653,153	I2310K	possibly damaging	Het
Ch25h	A	T	19: 34,475,014	I38N	probably benign	Het
Chrdl2	C	A	7: 100,020,922	P84Q	probably damaging	Het
Cltc	A	T	11: 86,695,577	Y1673N	possibly damaging	Het
Cr1l	C	G	1: 195,129,935	G27R	probably damaging	Het
Crebbp	G	A	16: 4,213,308		probably benign	Het
Dync1h1	G	A	12: 110,620,371	E929K	probably benign	Het
E2f7	C	A	10: 110,765,754	P324Q	probably damaging	Het
Eif3b	A	G	5: 140,425,439	D215G	probably benign	Het
Ephb1	A	G	9: 102,195,415	I55T	probably damaging	Het
Fam126a	A	G	5: 23,964,936	C472R	probably benign	Het
Fbxw14	A	T	9: 109,278,742	L188Q	probably damaging	Het
Foxg1	T	C	12: 49,385,161	S226P	probably damaging	Het
Gbe1	T	C	16: 70,478,322	F337L	probably damaging	Het
Glg1	A	T	8: 111,172,484	C716*	probably null	Het
Gm35339	A	T	15: 76,361,494	E1310D		Het
Gp1ba	C	G	11: 70,640,904		probably benign	Het
Grm7	C	T	6: 111,495,822	S36L	probably damaging	Het
H2-M5	T	A	17: 36,988,628	I167F	probably damaging	Het
Hist1h3e	T	C	13: 23,562,247	H40R	possibly damaging	Het
Il18rap	C	T	1: 40,543,017	T366M	probably benign	Het
Ino80	C	T	2: 119,383,381	R1236H	probably damaging	Het
Ism1	T	A	2: 139,732,075	I115N	possibly damaging	Het
Kdm4a	A	G	4: 118,142,376	S950P	probably benign	Het
Lama5	T	C	2: 180,193,799	T1254A	probably benign	Het
Lipo2	T	A	19: 33,720,961	K339*	probably null	Het
Lrrc7	T	C	3: 158,240,501	K187R	probably benign	Het
Mkrn2os	G	C	6: 115,585,356	S215R	probably benign	Het
Myzap	G	T	9: 71,550,203	D303E	possibly damaging	Het
Naa11	T	C	5: 97,392,225	N25D	probably damaging	Het
Naip5	T	A	13: 100,217,609	K1149*	probably null	Het
Obscn	C	T	11: 59,073,332	V3083M	probably damaging	Het
Olfr1298	T	C	2: 111,645,725	T91A	possibly damaging	Het
Olfr959	T	C	9: 39,572,795	T155A	probably benign	Het
Parn	T	A	16: 13,648,458	E241D	possibly damaging	Het
Pax1	T	A	2: 147,368,597		probably null	Het
Pclo	A	T	5: 14,675,355	E1409V	unknown	Het
Pclo	A	G	5: 14,713,042	Y3843C	unknown	Het
Ppp2r3a	A	T	9: 101,211,435	M563K	probably benign	Het
Prdm1	T	G	10: 44,440,733	K623Q	probably damaging	Het
Ptpn13	T	C	5: 103,551,107	V1152A	probably benign	Het
Ptx3	G	A	3: 66,220,970	A151T	probably benign	Het
Rab11fip1	T	C	8: 27,154,912	S282G	possibly damaging	Het
Ros1	G	T	10: 52,096,094	N1641K	probably damaging	Het
Syne1	T	C	10: 5,231,768	K4189R	probably benign	Het
Tcf3	T	C	10: 80,410,257	K611E	probably damaging	Het
Tmem215	A	G	4: 40,474,376	Q151R	probably benign	Het
Trappc8	T	C	18: 20,870,610	I254V	probably benign	Het
Trim46	T	C	3: 89,236,453	D556G	probably damaging	Het
Zfp513	C	A	5: 31,199,481	R487L	probably damaging	Het
Zmpste24	C	A	4: 121,087,311	E97*	probably null	Het

Other mutations in Brdt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02342:Brdt	APN	5	107342203	missense	probably damaging	1.00
IGL02718:Brdt	APN	5	107350068	splice site	probably benign
IGL02746:Brdt	APN	5	107370324	missense	probably benign
IGL02851:Brdt	APN	5	107377995	missense	possibly damaging	0.47
R0585:Brdt	UTSW	5	107356882	critical splice donor site	probably null
R0708:Brdt	UTSW	5	107358900	nonsense	probably null
R1338:Brdt	UTSW	5	107350188	missense	probably benign	0.02
R1710:Brdt	UTSW	5	107343584	missense	probably damaging	1.00
R1794:Brdt	UTSW	5	107359853	small deletion	probably benign
R1861:Brdt	UTSW	5	107359458	missense	probably benign
R1913:Brdt	UTSW	5	107348613	missense	probably benign
R2029:Brdt	UTSW	5	107359224	missense	probably benign	0.35
R2431:Brdt	UTSW	5	107378015	splice site	probably null
R3121:Brdt	UTSW	5	107377145	missense	probably damaging	0.99
R3122:Brdt	UTSW	5	107377145	missense	probably damaging	0.99
R4258:Brdt	UTSW	5	107359909	missense	probably damaging	0.97
R4609:Brdt	UTSW	5	107359936	missense	probably benign	0.00
R5306:Brdt	UTSW	5	107345144	missense	probably damaging	1.00
R5640:Brdt	UTSW	5	107359308	nonsense	probably null
R5677:Brdt	UTSW	5	107348617	missense	possibly damaging	0.85
R5936:Brdt	UTSW	5	107359395	missense	probably damaging	1.00
R6145:Brdt	UTSW	5	107377999	missense	possibly damaging	0.67
R6261:Brdt	UTSW	5	107348503	missense	probably benign	0.04
R6408:Brdt	UTSW	5	107385492	missense	probably damaging	1.00
R6930:Brdt	UTSW	5	107359215	missense	probably benign	0.35
R7372:Brdt	UTSW	5	107370294	missense	possibly damaging	0.49
R7741:Brdt	UTSW	5	107358886	missense	probably benign	0.00
R7842:Brdt	UTSW	5	107348588	missense	possibly damaging	0.49
R7869:Brdt	UTSW	5	107370179	missense	probably benign	0.04
R7887:Brdt	UTSW	5	107359933	missense	possibly damaging	0.66
R7972:Brdt	UTSW	5	107348549	missense	possibly damaging	0.53
R8064:Brdt	UTSW	5	107377996	nonsense	probably null
R9199:Brdt	UTSW	5	107350163	nonsense	probably null
R9346:Brdt	UTSW	5	107377014	missense	probably damaging	0.99
X0011:Brdt	UTSW	5	107342128	missense	probably damaging	0.96
X0011:Brdt	UTSW	5	107377092	missense	probably damaging	1.00
Z1176:Brdt	UTSW	5	107359898	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- CCAGGACATGGCTTTCTGTAG -3'
(R):5'- AGTGATTGCCCCACTCACAC -3'

Sequencing Primer
(F):5'- ACATGGCTTTCTGTAGTTGTTTAATC -3'
(R):5'- CAGTCTAATGGTCCCACAGTGTG -3'

Posted On

2021-08-31