Incidental Mutation 'R8958:Glg1'
ID 682166
Institutional Source Beutler Lab
Gene Symbol Glg1
Ensembl Gene ENSMUSG00000003316
Gene Name golgi apparatus protein 1
Synonyms Selel, CFR, MG-160, CFR-1, ESL-1, MG160
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.321) question?
Stock # R8958 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 111154421-111259216 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 111172484 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 716 (C716*)
Ref Sequence ENSEMBL: ENSMUSP00000131355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003404] [ENSMUST00000164283] [ENSMUST00000168741] [ENSMUST00000169020]
AlphaFold Q61543
Predicted Effect probably null
Transcript: ENSMUST00000003404
AA Change: C705*
SMART Domains Protein: ENSMUSP00000003404
Gene: ENSMUSG00000003316
AA Change: C705*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cys_rich_FGFR 141 197 3.1e-13 PFAM
Pfam:Cys_rich_FGFR 199 263 1.3e-16 PFAM
Pfam:Cys_rich_FGFR 274 331 1.5e-16 PFAM
Pfam:Cys_rich_FGFR 334 398 1.6e-16 PFAM
Pfam:Cys_rich_FGFR 402 458 1.8e-15 PFAM
Pfam:Cys_rich_FGFR 463 522 2.3e-16 PFAM
Pfam:Cys_rich_FGFR 525 589 5.8e-19 PFAM
Pfam:Cys_rich_FGFR 597 653 6e-17 PFAM
Pfam:Cys_rich_FGFR 654 714 2e-14 PFAM
Pfam:Cys_rich_FGFR 717 773 4.7e-14 PFAM
Pfam:Cys_rich_FGFR 784 841 1e-18 PFAM
Pfam:Cys_rich_FGFR 842 897 4.2e-17 PFAM
Pfam:Cys_rich_FGFR 900 964 2.1e-21 PFAM
Pfam:Cys_rich_FGFR 967 1027 3.5e-16 PFAM
Pfam:Cys_rich_FGFR 1029 1086 8e-17 PFAM
transmembrane domain 1131 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164283
SMART Domains Protein: ENSMUSP00000131659
Gene: ENSMUSG00000003316

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cys_rich_FGFR 149 208 2.3e-16 PFAM
Pfam:Cys_rich_FGFR 210 267 1.3e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000168741
AA Change: C109*
SMART Domains Protein: ENSMUSP00000130327
Gene: ENSMUSG00000003316
AA Change: C109*

DomainStartEndE-ValueType
Pfam:Cys_rich_FGFR 1 57 2.6e-17 PFAM
Pfam:Cys_rich_FGFR 58 118 8.5e-15 PFAM
Pfam:Cys_rich_FGFR 121 177 2e-14 PFAM
Pfam:Cys_rich_FGFR 188 245 4.3e-19 PFAM
Pfam:Cys_rich_FGFR 246 301 1.8e-17 PFAM
Pfam:Cys_rich_FGFR 304 368 8.9e-22 PFAM
Pfam:Cys_rich_FGFR 371 431 1.5e-16 PFAM
Pfam:Cys_rich_FGFR 459 513 1.6e-15 PFAM
transmembrane domain 558 580 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169020
AA Change: C716*
SMART Domains Protein: ENSMUSP00000131355
Gene: ENSMUSG00000003316
AA Change: C716*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cys_rich_FGFR 149 208 2.9e-15 PFAM
Pfam:Cys_rich_FGFR 210 274 1.3e-16 PFAM
Pfam:Cys_rich_FGFR 285 342 1.4e-16 PFAM
Pfam:Cys_rich_FGFR 345 409 7.2e-16 PFAM
Pfam:Cys_rich_FGFR 413 469 8.4e-16 PFAM
Pfam:Cys_rich_FGFR 474 533 6.4e-17 PFAM
Pfam:Cys_rich_FGFR 536 600 2.7e-16 PFAM
Pfam:Cys_rich_FGFR 608 664 2.6e-17 PFAM
Pfam:Cys_rich_FGFR 665 725 1.2e-13 PFAM
Pfam:Cys_rich_FGFR 728 784 2.6e-11 PFAM
Pfam:Cys_rich_FGFR 795 852 1.4e-18 PFAM
Pfam:Cys_rich_FGFR 853 908 1.1e-15 PFAM
Pfam:Cys_rich_FGFR 911 975 1e-19 PFAM
Pfam:Cys_rich_FGFR 978 1038 1.3e-15 PFAM
Pfam:Cys_rich_FGFR 1040 1097 6e-17 PFAM
transmembrane domain 1142 1164 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Nullizygous mice show smaller size, narrow rib cages, short and thin bony elements, and reduced chondrocyte proliferation and growth plates. Homozygotes for a gene trap allele show postnatal death, small size, distorted tails and cleft palate. Homozygotes for another gene trap allele die by E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 A T 12: 21,349,933 N157K possibly damaging Het
Adck2 T C 6: 39,583,914 V412A probably benign Het
Adgrb3 C T 1: 25,826,109 V11I possibly damaging Het
Arhgef17 T C 7: 100,929,812 D643G probably damaging Het
Arvcf A G 16: 18,402,626 Q597R probably damaging Het
Brdt T C 5: 107,378,011 V910A probably benign Het
Cachd1 A G 4: 100,994,086 D1167G probably benign Het
Ccdc187 A C 2: 26,275,565 S860A probably benign Het
Ccdc28a T C 10: 18,214,178 I113M probably benign Het
Cdc5l T C 17: 45,393,201 N699S probably benign Het
Cenpf A T 1: 189,653,153 I2310K possibly damaging Het
Ch25h A T 19: 34,475,014 I38N probably benign Het
Chrdl2 C A 7: 100,020,922 P84Q probably damaging Het
Cltc A T 11: 86,695,577 Y1673N possibly damaging Het
Cr1l C G 1: 195,129,935 G27R probably damaging Het
Crebbp G A 16: 4,213,308 probably benign Het
Dync1h1 G A 12: 110,620,371 E929K probably benign Het
E2f7 C A 10: 110,765,754 P324Q probably damaging Het
Eif3b A G 5: 140,425,439 D215G probably benign Het
Ephb1 A G 9: 102,195,415 I55T probably damaging Het
Fam126a A G 5: 23,964,936 C472R probably benign Het
Fbxw14 A T 9: 109,278,742 L188Q probably damaging Het
Foxg1 T C 12: 49,385,161 S226P probably damaging Het
Gbe1 T C 16: 70,478,322 F337L probably damaging Het
Gm35339 A T 15: 76,361,494 E1310D Het
Gp1ba C G 11: 70,640,904 probably benign Het
Grm7 C T 6: 111,495,822 S36L probably damaging Het
H2-M5 T A 17: 36,988,628 I167F probably damaging Het
Hist1h3e T C 13: 23,562,247 H40R possibly damaging Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Ino80 C T 2: 119,383,381 R1236H probably damaging Het
Ism1 T A 2: 139,732,075 I115N possibly damaging Het
Kdm4a A G 4: 118,142,376 S950P probably benign Het
Lama5 T C 2: 180,193,799 T1254A probably benign Het
Lipo2 T A 19: 33,720,961 K339* probably null Het
Lrrc7 T C 3: 158,240,501 K187R probably benign Het
Mkrn2os G C 6: 115,585,356 S215R probably benign Het
Myzap G T 9: 71,550,203 D303E possibly damaging Het
Naa11 T C 5: 97,392,225 N25D probably damaging Het
Naip5 T A 13: 100,217,609 K1149* probably null Het
Obscn C T 11: 59,073,332 V3083M probably damaging Het
Olfr1298 T C 2: 111,645,725 T91A possibly damaging Het
Olfr959 T C 9: 39,572,795 T155A probably benign Het
Parn T A 16: 13,648,458 E241D possibly damaging Het
Pax1 T A 2: 147,368,597 probably null Het
Pclo A T 5: 14,675,355 E1409V unknown Het
Pclo A G 5: 14,713,042 Y3843C unknown Het
Ppp2r3a A T 9: 101,211,435 M563K probably benign Het
Prdm1 T G 10: 44,440,733 K623Q probably damaging Het
Ptpn13 T C 5: 103,551,107 V1152A probably benign Het
Ptx3 G A 3: 66,220,970 A151T probably benign Het
Rab11fip1 T C 8: 27,154,912 S282G possibly damaging Het
Ros1 G T 10: 52,096,094 N1641K probably damaging Het
Syne1 T C 10: 5,231,768 K4189R probably benign Het
Tcf3 T C 10: 80,410,257 K611E probably damaging Het
Tmem215 A G 4: 40,474,376 Q151R probably benign Het
Trappc8 T C 18: 20,870,610 I254V probably benign Het
Trim46 T C 3: 89,236,453 D556G probably damaging Het
Zfp513 C A 5: 31,199,481 R487L probably damaging Het
Zmpste24 C A 4: 121,087,311 E97* probably null Het
Other mutations in Glg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Glg1 APN 8 111159849 missense probably damaging 1.00
IGL01326:Glg1 APN 8 111182573 missense probably damaging 0.96
IGL01558:Glg1 APN 8 111187730 missense probably benign 0.00
IGL01798:Glg1 APN 8 111192700 missense possibly damaging 0.58
IGL02651:Glg1 APN 8 111160727 missense possibly damaging 0.76
IGL03124:Glg1 APN 8 111200171 missense probably damaging 1.00
IGL03374:Glg1 APN 8 111162780 missense probably damaging 1.00
IGL03404:Glg1 APN 8 111159902 missense probably damaging 1.00
diabolical UTSW 8 111168743 missense probably damaging 1.00
BB007:Glg1 UTSW 8 111160735 missense possibly damaging 0.46
BB017:Glg1 UTSW 8 111160735 missense possibly damaging 0.46
PIT4362001:Glg1 UTSW 8 111258799 missense possibly damaging 0.80
R0047:Glg1 UTSW 8 111165582 missense probably damaging 1.00
R0047:Glg1 UTSW 8 111165582 missense probably damaging 1.00
R0255:Glg1 UTSW 8 111159858 missense possibly damaging 0.82
R0432:Glg1 UTSW 8 111182569 missense probably damaging 1.00
R0458:Glg1 UTSW 8 111160606 splice site probably benign
R0635:Glg1 UTSW 8 111163764 splice site probably benign
R0765:Glg1 UTSW 8 111159797 critical splice donor site probably null
R1104:Glg1 UTSW 8 111197603 missense probably benign 0.01
R1495:Glg1 UTSW 8 111197675 missense probably damaging 1.00
R1747:Glg1 UTSW 8 111197673 missense probably damaging 1.00
R1899:Glg1 UTSW 8 111165674 missense probably benign 0.23
R1950:Glg1 UTSW 8 111165639 missense possibly damaging 0.79
R2074:Glg1 UTSW 8 111168671 missense probably damaging 1.00
R2112:Glg1 UTSW 8 111192546 missense probably damaging 1.00
R2275:Glg1 UTSW 8 111168721 nonsense probably null
R2342:Glg1 UTSW 8 111187807 nonsense probably null
R4633:Glg1 UTSW 8 111177644 critical splice donor site probably null
R4716:Glg1 UTSW 8 111160775 nonsense probably null
R4732:Glg1 UTSW 8 111187755 missense probably damaging 1.00
R4733:Glg1 UTSW 8 111187755 missense probably damaging 1.00
R5594:Glg1 UTSW 8 111187881 missense probably damaging 1.00
R5722:Glg1 UTSW 8 111169562 missense possibly damaging 0.67
R5951:Glg1 UTSW 8 111165691 missense possibly damaging 0.64
R5958:Glg1 UTSW 8 111259104 missense probably benign 0.01
R6090:Glg1 UTSW 8 111181035 missense probably damaging 1.00
R6476:Glg1 UTSW 8 111200174 missense possibly damaging 0.94
R6480:Glg1 UTSW 8 111197706 missense possibly damaging 0.89
R6819:Glg1 UTSW 8 111187881 missense probably damaging 1.00
R7116:Glg1 UTSW 8 111178957 missense probably benign 0.22
R7293:Glg1 UTSW 8 111168743 missense probably damaging 1.00
R7431:Glg1 UTSW 8 111160754 missense unknown
R7479:Glg1 UTSW 8 111197735 missense possibly damaging 0.91
R7509:Glg1 UTSW 8 111259043 missense probably benign 0.04
R7547:Glg1 UTSW 8 111187761 missense possibly damaging 0.89
R7678:Glg1 UTSW 8 111178865 missense probably benign 0.19
R7930:Glg1 UTSW 8 111160735 missense possibly damaging 0.46
R8182:Glg1 UTSW 8 111171297 missense possibly damaging 0.88
R8383:Glg1 UTSW 8 111169562 missense possibly damaging 0.67
R8787:Glg1 UTSW 8 111161482 missense probably damaging 0.99
R8905:Glg1 UTSW 8 111158036 missense probably damaging 0.99
R8954:Glg1 UTSW 8 111187895 missense probably damaging 1.00
R9023:Glg1 UTSW 8 111177748 missense probably damaging 0.99
R9113:Glg1 UTSW 8 111160820 intron probably benign
R9359:Glg1 UTSW 8 111187793 missense probably benign 0.08
R9403:Glg1 UTSW 8 111187793 missense probably benign 0.08
R9553:Glg1 UTSW 8 111200138 missense probably benign 0.04
R9622:Glg1 UTSW 8 111172501 missense probably damaging 1.00
R9714:Glg1 UTSW 8 111197669 missense probably damaging 1.00
X0027:Glg1 UTSW 8 111169600 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGCTGTTGAGAAAAGCCCAG -3'
(R):5'- GCTGAATTGCTATCGTTCCTG -3'

Sequencing Primer
(F):5'- AGCCCAGTTTATTGAGAAGCTG -3'
(R):5'- GCTGAATTGCTATCGTTCCTGATTTC -3'
Posted On 2021-08-31