Incidental Mutation 'R8959:Urb1'
ID 682235
Institutional Source Beutler Lab
Gene Symbol Urb1
Ensembl Gene ENSMUSG00000039929
Gene Name URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Synonyms 4921511H13Rik, 5730405K23Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8959 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 90751527-90810413 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 90774117 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1268 (D1268G)
Ref Sequence ENSEMBL: ENSMUSP00000114717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140920]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000140920
AA Change: D1268G

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114717
Gene: ENSMUSG00000039929
AA Change: D1268G

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:Npa1 78 396 1.5e-86 PFAM
low complexity region 751 761 N/A INTRINSIC
low complexity region 955 966 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
low complexity region 1360 1375 N/A INTRINSIC
Pfam:NopRA1 1670 1859 3.6e-60 PFAM
low complexity region 2029 2040 N/A INTRINSIC
low complexity region 2092 2111 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028P14Rik T C 19: 23,559,021 E174G possibly damaging Het
Acp4 G T 7: 44,256,975 T51K possibly damaging Het
Angel2 C T 1: 190,933,135 R88C probably damaging Het
Ankrd13b G A 11: 77,476,626 R181C probably damaging Het
Arntl2 T C 6: 146,820,644 C238R probably benign Het
Brd3 C T 2: 27,464,001 R33Q probably damaging Het
Ccdc106 T A 7: 5,057,501 L20Q probably benign Het
Ccdc117 A T 11: 5,541,421 V62D possibly damaging Het
Ccnt1 T C 15: 98,543,215 probably benign Het
Cmip G A 8: 117,411,315 V178I probably benign Het
Cnnm3 A G 1: 36,519,015 E436G probably damaging Het
Dcaf11 A G 14: 55,569,304 N488S probably benign Het
Dlg2 A T 7: 90,852,719 K80* probably null Het
Dnase1l2 T A 17: 24,442,668 D39V probably damaging Het
Dysf A G 6: 84,101,963 D708G probably benign Het
Enpep A T 3: 129,319,441 L278Q probably damaging Het
Ephb6 C T 6: 41,613,359 A15V probably benign Het
Flt3 T G 5: 147,366,964 Q388P possibly damaging Het
Hltf A G 3: 20,082,772 Y329C probably damaging Het
Hmcn2 C T 2: 31,392,147 P1924S probably damaging Het
Iba57 A G 11: 59,161,635 V122A probably benign Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Irak2 T A 6: 113,647,741 M66K probably damaging Het
Mkrn2os G C 6: 115,585,356 S215R probably benign Het
Mpped1 G A 15: 83,792,141 R36Q probably damaging Het
Myh1 C A 11: 67,211,502 A873E probably benign Het
Nedd9 G T 13: 41,316,282 A465D probably damaging Het
Nr2f1 G T 13: 78,189,754 Y257* probably null Het
Olfr1106 T A 2: 87,049,207 T10S possibly damaging Het
Olfr771 A G 10: 129,160,615 I123T probably damaging Het
Omd A G 13: 49,592,314 E400G possibly damaging Het
Patj T C 4: 98,591,975 S1306P probably damaging Het
Pdzph1 T C 17: 58,974,604 K228E probably damaging Het
Prl2c5 A G 13: 13,190,807 probably benign Het
Rad18 T C 6: 112,628,483 E410G probably damaging Het
Rp1 T A 1: 4,349,427 probably benign Het
Runx3 C T 4: 135,175,657 S366L probably damaging Het
Ssh3 T A 19: 4,268,562 R30S probably damaging Het
Stxbp5l ATTTT ATTTTT 16: 37,216,052 probably null Het
Taf6l A G 19: 8,773,326 F128S possibly damaging Het
Tmc6 A C 11: 117,770,467 probably null Het
Trpc3 T G 3: 36,655,109 Q406P probably benign Het
Uncx C A 5: 139,544,071 Y26* probably null Het
Wif1 T C 10: 121,096,052 C294R probably damaging Het
Zfp521 C A 18: 13,846,080 L425F probably damaging Het
Zfp78 A G 7: 6,379,381 R477G probably damaging Het
Other mutations in Urb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Urb1 APN 16 90753321 critical splice donor site probably null
IGL00915:Urb1 APN 16 90779098 missense possibly damaging 0.76
IGL01108:Urb1 APN 16 90792814 missense probably damaging 1.00
IGL01122:Urb1 APN 16 90804458 missense possibly damaging 0.81
IGL01387:Urb1 APN 16 90757761 missense possibly damaging 0.64
IGL01484:Urb1 APN 16 90777560 missense probably benign 0.11
IGL01606:Urb1 APN 16 90760459 missense probably damaging 1.00
IGL01989:Urb1 APN 16 90769586 splice site probably benign
IGL02516:Urb1 APN 16 90772695 missense possibly damaging 0.49
IGL03018:Urb1 APN 16 90788156 missense probably benign 0.02
IGL03165:Urb1 APN 16 90780304 missense probably damaging 1.00
IGL03216:Urb1 APN 16 90788114 missense probably benign 0.00
H8562:Urb1 UTSW 16 90769469 missense probably benign 0.08
H8786:Urb1 UTSW 16 90769469 missense probably benign 0.08
R0064:Urb1 UTSW 16 90779140 missense probably benign
R0064:Urb1 UTSW 16 90779140 missense probably benign
R0359:Urb1 UTSW 16 90791160 missense probably damaging 1.00
R0386:Urb1 UTSW 16 90796399 missense probably damaging 1.00
R0508:Urb1 UTSW 16 90783262 splice site probably benign
R0517:Urb1 UTSW 16 90777422 nonsense probably null
R0704:Urb1 UTSW 16 90776207 missense probably benign 0.31
R0755:Urb1 UTSW 16 90774094 missense probably damaging 1.00
R0755:Urb1 UTSW 16 90779138 missense probably benign
R0783:Urb1 UTSW 16 90810297 missense possibly damaging 0.55
R0833:Urb1 UTSW 16 90795448 missense possibly damaging 0.89
R0836:Urb1 UTSW 16 90795448 missense possibly damaging 0.89
R0970:Urb1 UTSW 16 90769447 missense possibly damaging 0.83
R1144:Urb1 UTSW 16 90776318 splice site probably null
R1344:Urb1 UTSW 16 90769466 missense probably damaging 1.00
R1418:Urb1 UTSW 16 90769466 missense probably damaging 1.00
R1453:Urb1 UTSW 16 90796492 missense probably damaging 1.00
R1470:Urb1 UTSW 16 90752014 missense probably benign 0.34
R1470:Urb1 UTSW 16 90752014 missense probably benign 0.34
R1520:Urb1 UTSW 16 90774745 missense probably benign 0.00
R1521:Urb1 UTSW 16 90753863 missense probably damaging 1.00
R1598:Urb1 UTSW 16 90777440 missense possibly damaging 0.93
R1617:Urb1 UTSW 16 90760452 missense possibly damaging 0.82
R1625:Urb1 UTSW 16 90774048 critical splice donor site probably null
R1640:Urb1 UTSW 16 90772626 missense probably benign 0.00
R1664:Urb1 UTSW 16 90788082 critical splice donor site probably null
R1672:Urb1 UTSW 16 90787397 missense probably damaging 1.00
R1694:Urb1 UTSW 16 90767040 missense probably benign
R1856:Urb1 UTSW 16 90761695 missense probably benign 0.00
R2001:Urb1 UTSW 16 90762344 missense probably benign 0.30
R2196:Urb1 UTSW 16 90774256 missense probably benign 0.01
R2850:Urb1 UTSW 16 90774256 missense probably benign 0.01
R3009:Urb1 UTSW 16 90774798 missense probably benign 0.09
R3104:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3105:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3106:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3160:Urb1 UTSW 16 90797903 missense probably damaging 1.00
R3162:Urb1 UTSW 16 90797903 missense probably damaging 1.00
R3900:Urb1 UTSW 16 90783376 missense possibly damaging 0.86
R4014:Urb1 UTSW 16 90769465 missense probably damaging 1.00
R4036:Urb1 UTSW 16 90788086 missense probably benign
R4332:Urb1 UTSW 16 90774537 missense probably damaging 1.00
R4448:Urb1 UTSW 16 90769394 missense possibly damaging 0.71
R4581:Urb1 UTSW 16 90788146 missense probably benign 0.04
R4593:Urb1 UTSW 16 90787444 missense probably damaging 1.00
R4610:Urb1 UTSW 16 90776271 missense probably benign 0.43
R4659:Urb1 UTSW 16 90776129 missense probably damaging 0.96
R4672:Urb1 UTSW 16 90772634 missense probably benign
R4681:Urb1 UTSW 16 90804537 missense probably damaging 0.99
R4771:Urb1 UTSW 16 90753518 missense probably benign 0.00
R4790:Urb1 UTSW 16 90769555 nonsense probably null
R4798:Urb1 UTSW 16 90757827 missense probably benign 0.12
R4809:Urb1 UTSW 16 90759842 missense possibly damaging 0.82
R4850:Urb1 UTSW 16 90795414 nonsense probably null
R4916:Urb1 UTSW 16 90783328 missense probably damaging 1.00
R4969:Urb1 UTSW 16 90805411 missense probably damaging 1.00
R5032:Urb1 UTSW 16 90756171 missense probably benign 0.00
R5111:Urb1 UTSW 16 90752017 missense probably benign 0.00
R5122:Urb1 UTSW 16 90752095 nonsense probably null
R5184:Urb1 UTSW 16 90783274 critical splice donor site probably null
R5199:Urb1 UTSW 16 90792748 missense possibly damaging 0.95
R5436:Urb1 UTSW 16 90792762 missense probably damaging 1.00
R5767:Urb1 UTSW 16 90776163 missense probably benign 0.00
R5812:Urb1 UTSW 16 90804537 missense probably damaging 0.99
R5872:Urb1 UTSW 16 90772764 nonsense probably null
R6052:Urb1 UTSW 16 90762383 missense probably damaging 1.00
R6063:Urb1 UTSW 16 90789097 missense probably benign 0.02
R6065:Urb1 UTSW 16 90803332 missense probably benign 0.03
R6181:Urb1 UTSW 16 90779094 missense probably benign 0.00
R6268:Urb1 UTSW 16 90753919 missense probably benign 0.03
R6429:Urb1 UTSW 16 90762430 splice site probably null
R6572:Urb1 UTSW 16 90787414 missense probably benign 0.37
R6606:Urb1 UTSW 16 90810268 missense probably benign 0.00
R6730:Urb1 UTSW 16 90779083 missense possibly damaging 0.89
R6838:Urb1 UTSW 16 90782106 missense possibly damaging 0.93
R7237:Urb1 UTSW 16 90791166 missense probably damaging 1.00
R7238:Urb1 UTSW 16 90752115 missense possibly damaging 0.88
R7339:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7341:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7361:Urb1 UTSW 16 90774768 missense probably damaging 0.99
R7365:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7366:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7440:Urb1 UTSW 16 90787408 missense probably damaging 1.00
R7530:Urb1 UTSW 16 90761634 missense probably damaging 1.00
R7553:Urb1 UTSW 16 90792864 missense probably damaging 1.00
R7557:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7603:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7607:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7609:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7610:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7612:Urb1 UTSW 16 90797910 missense probably damaging 1.00
R7613:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7684:Urb1 UTSW 16 90786118 nonsense probably null
R8029:Urb1 UTSW 16 90779152 missense possibly damaging 0.67
R8324:Urb1 UTSW 16 90791190 missense probably damaging 1.00
R8680:Urb1 UTSW 16 90774625 missense probably benign 0.00
R8785:Urb1 UTSW 16 90803423 missense probably benign 0.07
R8914:Urb1 UTSW 16 90810234 missense probably damaging 1.00
R9005:Urb1 UTSW 16 90753790 missense probably benign 0.01
R9126:Urb1 UTSW 16 90769402 missense possibly damaging 0.53
R9195:Urb1 UTSW 16 90792750 missense probably benign 0.03
R9276:Urb1 UTSW 16 90772575 splice site probably benign
R9534:Urb1 UTSW 16 90786208 missense possibly damaging 0.54
Z1177:Urb1 UTSW 16 90753883 missense probably benign 0.00
Z1177:Urb1 UTSW 16 90774862 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGCCTAAAGAGGTTCCAGTGAG -3'
(R):5'- AGACTCTTCAGAAAGACCCCGTG -3'

Sequencing Primer
(F):5'- CCTAAAGAGGTTCCAGTGAGGATAAG -3'
(R):5'- AGAAAGACCCCGTGCTGGC -3'
Posted On 2021-08-31