Incidental Mutation 'R0735:Trip6'
ID68225
Institutional Source Beutler Lab
Gene Symbol Trip6
Ensembl Gene ENSMUSG00000023348
Gene Namethyroid hormone receptor interactor 6
Synonyms
MMRRC Submission 038916-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0735 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location137309654-137314404 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137310821 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 341 (E341G)
Ref Sequence ENSEMBL: ENSMUSP00000024119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024119] [ENSMUST00000039991] [ENSMUST00000040873] [ENSMUST00000197466] [ENSMUST00000197484] [ENSMUST00000198526] [ENSMUST00000199121] [ENSMUST00000199243]
Predicted Effect probably benign
Transcript: ENSMUST00000024119
AA Change: E341G

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000024119
Gene: ENSMUSG00000023348
AA Change: E341G

DomainStartEndE-ValueType
low complexity region 155 171 N/A INTRINSIC
low complexity region 222 234 N/A INTRINSIC
low complexity region 239 262 N/A INTRINSIC
LIM 282 335 4.59e-14 SMART
LIM 342 394 1.41e-14 SMART
LIM 402 464 5.65e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000039991
SMART Domains Protein: ENSMUSP00000038106
Gene: ENSMUSG00000037344

DomainStartEndE-ValueType
Pfam:AA_permease 42 536 1.8e-114 PFAM
Pfam:SLC12 545 639 4.6e-13 PFAM
low complexity region 804 817 N/A INTRINSIC
low complexity region 845 866 N/A INTRINSIC
low complexity region 871 888 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040873
SMART Domains Protein: ENSMUSP00000043123
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 153 262 3.8e-44 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 645 850 9.7e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197466
SMART Domains Protein: ENSMUSP00000142564
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 9.5e-48 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 635 845 5.5e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197484
SMART Domains Protein: ENSMUSP00000142660
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 41 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198216
Predicted Effect probably benign
Transcript: ENSMUST00000198526
SMART Domains Protein: ENSMUSP00000142435
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 2e-45 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 369 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199121
Predicted Effect probably benign
Transcript: ENSMUST00000199243
SMART Domains Protein: ENSMUSP00000143232
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 9.5e-48 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 635 849 9.8e-115 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199564
Meta Mutation Damage Score 0.2317 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.7%
  • 20x: 91.8%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the zyxin family and encodes a protein with three LIM zinc-binding domains. This protein localizes to focal adhesion sites and along actin stress fibers. Recruitment of this protein to the plasma membrane occurs in a lysophosphatidic acid (LPA)-dependent manner and it regulates LPA-induced cell migration. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,717,638 I1552K possibly damaging Het
Actr8 T A 14: 29,989,712 M405K probably benign Het
Adam10 G A 9: 70,748,251 V334I possibly damaging Het
Adgra2 G T 8: 27,117,318 G686C probably damaging Het
Akap11 A T 14: 78,510,078 I1623N probably damaging Het
Astn1 A T 1: 158,472,389 T100S possibly damaging Het
B3galt1 A C 2: 68,118,579 I213L possibly damaging Het
B4galnt4 A G 7: 141,064,323 K101E probably benign Het
Camsap2 A G 1: 136,292,888 S324P probably damaging Het
Chrnb4 A G 9: 55,043,800 S60P probably damaging Het
Cpne1 A G 2: 156,078,750 probably null Het
Cubn G A 2: 13,491,689 probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cxcl15 T C 5: 90,801,294 M106T probably benign Het
Cyp2c23 A T 19: 44,016,810 M140K probably damaging Het
Dgke A G 11: 89,060,075 F104S probably benign Het
Dhx36 T A 3: 62,472,729 M849L probably benign Het
Dnah7a C T 1: 53,544,511 E1522K possibly damaging Het
Edil3 G T 13: 89,177,178 V219F probably damaging Het
Egln1 A G 8: 124,948,495 V187A possibly damaging Het
Fam193a T C 5: 34,439,378 I455T possibly damaging Het
Fdft1 A T 14: 63,163,420 I88N probably damaging Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Frs2 T A 10: 117,074,582 S292C probably damaging Het
Gm15448 T C 7: 3,821,782 T533A possibly damaging Het
Gpr107 T A 2: 31,171,994 F145I probably benign Het
Gpr153 T A 4: 152,279,373 C83* probably null Het
H2-Q7 T G 17: 35,440,186 probably null Het
Hsp90b1 A T 10: 86,695,748 probably benign Het
Kcnk1 C A 8: 126,025,289 N211K probably damaging Het
Klb T C 5: 65,379,727 V800A probably benign Het
Lat2 T C 5: 134,606,783 Y59C probably damaging Het
Mlkl A T 8: 111,327,801 probably benign Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mtbp T A 15: 55,562,942 C93* probably null Het
Myo7a A G 7: 98,081,180 probably benign Het
Myt1 G A 2: 181,807,387 probably benign Het
Ogfrl1 T C 1: 23,375,754 Q224R possibly damaging Het
Olfr418 A G 1: 173,271,002 T276A probably benign Het
Olfr661 A T 7: 104,688,819 H268L probably damaging Het
Osbpl2 A G 2: 180,150,290 probably benign Het
Plb1 C T 5: 32,284,920 T252M possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbsn T C 6: 92,189,693 T657A probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rps6kb2 C A 19: 4,157,883 S348I probably benign Het
Rsrp1 C T 4: 134,924,257 R111W unknown Het
Ryr3 T C 2: 112,732,982 T2933A probably benign Het
Scara5 A G 14: 65,731,019 D247G possibly damaging Het
Slc7a11 C T 3: 50,424,096 S231N probably benign Het
Sod2 A T 17: 13,010,564 N91Y probably damaging Het
Spesp1 A T 9: 62,272,685 S314T probably benign Het
St3gal1 C A 15: 67,113,687 M39I probably benign Het
Stat6 A T 10: 127,658,241 I646F probably damaging Het
Tdrd1 A T 19: 56,865,978 K1119* probably null Het
Thbs2 A G 17: 14,679,815 I600T probably benign Het
Tor1a A G 2: 30,963,838 V160A probably damaging Het
Trdmt1 T G 2: 13,523,438 D104A probably benign Het
Trim58 T C 11: 58,651,393 V393A probably benign Het
Trip4 C T 9: 65,884,918 probably benign Het
Ttn T A 2: 76,715,195 I32595F probably damaging Het
Ubr4 T A 4: 139,428,028 probably null Het
Ush2a G A 1: 188,864,693 V3877I probably benign Het
Vmn1r29 G T 6: 58,307,732 G146C probably damaging Het
Vmn2r53 A G 7: 12,581,780 V704A probably benign Het
Vmn2r7 C T 3: 64,716,367 M268I probably benign Het
Wnt7b G A 15: 85,537,495 T248M probably damaging Het
Xab2 G A 8: 3,613,649 P394S possibly damaging Het
Zfp663 A G 2: 165,359,075 V13A probably damaging Het
Other mutations in Trip6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01595:Trip6 APN 5 137313413 missense probably benign 0.02
IGL02330:Trip6 APN 5 137313358 missense probably benign 0.01
IGL02471:Trip6 APN 5 137310356 missense probably benign 0.45
IGL03171:Trip6 APN 5 137312884 missense probably benign 0.01
R0058:Trip6 UTSW 5 137310845 unclassified probably benign
R0139:Trip6 UTSW 5 137312174 missense probably benign 0.01
R0270:Trip6 UTSW 5 137312841 missense probably benign
R0464:Trip6 UTSW 5 137313681 missense probably damaging 1.00
R1169:Trip6 UTSW 5 137311920 missense probably benign 0.09
R3917:Trip6 UTSW 5 137313679 missense probably benign 0.40
R4774:Trip6 UTSW 5 137310171 missense probably damaging 1.00
R5177:Trip6 UTSW 5 137312172 missense probably damaging 1.00
R7008:Trip6 UTSW 5 137312966 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCGATGTGGAAACTTCGATCCAG -3'
(R):5'- TGCTGCTCTTAGACCTCAGAAATGC -3'

Sequencing Primer
(F):5'- CATCGTGGGGCAAATTTCC -3'
(R):5'- TCTTAGACCTCAGAAATGCTAAGTCC -3'
Posted On2013-09-03