Incidental Mutation 'R8960:Insrr'
ID 682262
Institutional Source Beutler Lab
Gene Symbol Insrr
Ensembl Gene ENSMUSG00000005640
Gene Name insulin receptor-related receptor
Synonyms
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.274) question?
Stock # R8960 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 87704258-87723408 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 87720386 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 1008 (T1008K)
Ref Sequence ENSEMBL: ENSMUSP00000103208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029711] [ENSMUST00000029714] [ENSMUST00000090981] [ENSMUST00000107582]
AlphaFold Q9WTL4
Predicted Effect probably damaging
Transcript: ENSMUST00000029711
AA Change: T1008K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029711
Gene: ENSMUSG00000005640
AA Change: T1008K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Recep_L_domain 47 159 1.8e-25 PFAM
FU 225 268 9.54e-11 SMART
Pfam:Recep_L_domain 346 460 3.8e-28 PFAM
FN3 483 586 9.19e-1 SMART
FN3 605 798 6.45e-5 SMART
FN3 816 899 6.35e-4 SMART
TyrKc 979 1246 4.61e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029714
SMART Domains Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090981
SMART Domains Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107582
AA Change: T1008K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103208
Gene: ENSMUSG00000005640
AA Change: T1008K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Recep_L_domain 47 159 7.7e-25 PFAM
FU 225 268 9.54e-11 SMART
Pfam:Recep_L_domain 346 460 1.6e-28 PFAM
FN3 483 586 9.19e-1 SMART
FN3 605 798 6.45e-5 SMART
FN3 816 899 6.35e-4 SMART
TyrKc 979 1246 4.61e-128 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (78/78)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no anomalies in pancreatic islet morphology, beta-cell mass or pancreatic secretory function. This mutation in combination with Insr mutant mice does not affect the diabetes predisposition of Insr mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 G A 9: 44,186,063 (GRCm39) Q603* probably null Het
Adar A G 3: 89,647,516 (GRCm39) Y165C probably damaging Het
Afp A G 5: 90,651,500 (GRCm39) T372A probably benign Het
Asah1 T A 8: 41,800,061 (GRCm39) L184F probably damaging Het
Bltp1 A G 3: 37,067,132 (GRCm39) E3548G probably damaging Het
Bpifb2 A T 2: 153,731,046 (GRCm39) I206F possibly damaging Het
Btn1a1 C A 13: 23,648,741 (GRCm39) D31Y possibly damaging Het
C4b T A 17: 34,952,892 (GRCm39) D1110V probably damaging Het
Ccdc162 T A 10: 41,429,178 (GRCm39) D1901V probably damaging Het
Cd101 A G 3: 100,910,817 (GRCm39) V947A probably benign Het
Cd55b A T 1: 130,338,375 (GRCm39) S238T possibly damaging Het
Cdc25c T C 18: 34,866,329 (GRCm39) I437V possibly damaging Het
Cfap97 T C 8: 46,623,605 (GRCm39) S332P probably damaging Het
Chpf A G 1: 75,452,398 (GRCm39) L352P probably damaging Het
Cntln T A 4: 85,018,961 (GRCm39) M1217K possibly damaging Het
Cntrl A G 2: 35,052,053 (GRCm39) E1629G possibly damaging Het
Csnk1g2 T C 10: 80,474,396 (GRCm39) Y206H probably damaging Het
Cyp2c55 T A 19: 38,995,547 (GRCm39) W20R probably null Het
Dhx35 A T 2: 158,657,393 (GRCm39) H130L possibly damaging Het
Dnm1 A G 2: 32,202,741 (GRCm39) V54A probably damaging Het
Eea1 T A 10: 95,864,381 (GRCm39) S967T probably benign Het
Efcab3 A G 11: 104,820,772 (GRCm39) probably benign Het
Elf3 A T 1: 135,182,813 (GRCm39) I304N probably damaging Het
Eps8l1 G T 7: 4,481,214 (GRCm39) R672L probably damaging Het
Fam163a A T 1: 155,954,862 (GRCm39) C96* probably null Het
Fancd2 T C 6: 113,540,129 (GRCm39) probably null Het
Fbxo3 C T 2: 103,858,274 (GRCm39) L23F possibly damaging Het
Fbxw14 A G 9: 109,114,367 (GRCm39) V121A possibly damaging Het
Fgd6 T A 10: 93,880,868 (GRCm39) V574D probably benign Het
Gask1b T C 3: 79,794,293 (GRCm39) S254P probably benign Het
Gbp11 A G 5: 105,479,251 (GRCm39) F124S probably damaging Het
Grin1 A T 2: 25,195,428 (GRCm39) probably benign Het
Grm2 T G 9: 106,531,345 (GRCm39) E48A probably benign Het
H2-M10.5 T A 17: 37,084,770 (GRCm39) Y165N probably benign Het
Hoxa13 A C 6: 52,236,976 (GRCm39) S172A probably benign Het
Ifih1 T A 2: 62,442,235 (GRCm39) K376N possibly damaging Het
Itih1 A G 14: 30,655,414 (GRCm39) S594P probably damaging Het
Kidins220 T C 12: 25,106,914 (GRCm39) S1365P probably benign Het
Malrd1 A T 2: 15,570,241 (GRCm39) K158* probably null Het
Man2c1 G A 9: 57,045,279 (GRCm39) G504R probably damaging Het
Mbd1 T C 18: 74,406,890 (GRCm39) probably null Het
Micall2 G A 5: 139,702,025 (GRCm39) A323V probably benign Het
Mroh9 A C 1: 162,883,196 (GRCm39) F428V probably benign Het
Myo7b T A 18: 32,127,299 (GRCm39) probably benign Het
Niban1 A T 1: 151,591,463 (GRCm39) H535L possibly damaging Het
Obscn A T 11: 58,922,438 (GRCm39) V6567E probably damaging Het
Or1e28-ps1 A C 11: 73,615,230 (GRCm39) S207A unknown Het
Or1e33 A T 11: 73,738,167 (GRCm39) C261* probably null Het
Or2g25 T A 17: 37,970,760 (GRCm39) T155S probably benign Het
Or2y1d A T 11: 49,321,543 (GRCm39) Q80L probably benign Het
Or5h25 T A 16: 58,930,555 (GRCm39) R139S probably benign Het
Or8b53 A T 9: 38,667,385 (GRCm39) I134F possibly damaging Het
Pde4dip T C 3: 97,700,464 (GRCm39) D238G probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 (GRCm39) probably benign Het
Pgbd5 T A 8: 125,111,175 (GRCm39) Y172F probably benign Het
Pkd1 A G 17: 24,795,176 (GRCm39) T2288A probably damaging Het
Ppp6r2 T A 15: 89,137,239 (GRCm39) M1K probably null Het
Rc3h1 A G 1: 160,774,164 (GRCm39) T344A probably damaging Het
Rgs5 T C 1: 169,504,461 (GRCm39) V37A possibly damaging Het
Rgs9 A G 11: 109,139,815 (GRCm39) S17P possibly damaging Het
Rusc1 T A 3: 88,991,865 (GRCm39) D407V probably damaging Het
Rwdd1 T A 10: 33,895,383 (GRCm39) I18F possibly damaging Het
Satb2 C T 1: 56,910,470 (GRCm39) probably null Het
Sds A G 5: 120,621,659 (GRCm39) E267G probably damaging Het
Sema4b T A 7: 79,875,076 (GRCm39) V822E probably damaging Het
Sfxn5 A T 6: 85,266,176 (GRCm39) M107K probably damaging Het
Slc5a8 C T 10: 88,722,035 (GRCm39) probably benign Het
Sorbs1 T C 19: 40,387,048 (GRCm39) D6G probably damaging Het
Syt14 A C 1: 192,666,515 (GRCm39) probably benign Het
Vmn2r124 T G 17: 18,283,291 (GRCm39) Y328* probably null Het
Vmn2r86 T A 10: 130,289,672 (GRCm39) E74D probably benign Het
Vmo1 A C 11: 70,404,476 (GRCm39) L175W probably damaging Het
Vps13a G T 19: 16,683,247 (GRCm39) L982I possibly damaging Het
Wdr19 T C 5: 65,398,211 (GRCm39) V812A probably benign Het
Wdr27 T C 17: 15,103,908 (GRCm39) I733V probably benign Het
Wdr54 A T 6: 83,132,739 (GRCm39) H38Q probably damaging Het
Wdr76 G A 2: 121,341,104 (GRCm39) V50I probably damaging Het
Zfp930 T A 8: 69,680,541 (GRCm39) N59K probably damaging Het
Zfyve9 T C 4: 108,501,558 (GRCm39) N1218S possibly damaging Het
Other mutations in Insrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Insrr APN 3 87,720,981 (GRCm39) critical splice donor site probably null
IGL00801:Insrr APN 3 87,721,115 (GRCm39) missense probably damaging 1.00
IGL01628:Insrr APN 3 87,708,099 (GRCm39) nonsense probably null
IGL01755:Insrr APN 3 87,721,493 (GRCm39) missense probably damaging 1.00
IGL02100:Insrr APN 3 87,718,927 (GRCm39) missense probably damaging 1.00
IGL02261:Insrr APN 3 87,708,029 (GRCm39) missense probably damaging 1.00
IGL02366:Insrr APN 3 87,717,216 (GRCm39) missense possibly damaging 0.91
IGL02387:Insrr APN 3 87,720,434 (GRCm39) missense probably damaging 1.00
IGL02478:Insrr APN 3 87,716,719 (GRCm39) missense probably benign 0.14
IGL02550:Insrr APN 3 87,711,805 (GRCm39) missense probably damaging 1.00
IGL02555:Insrr APN 3 87,721,124 (GRCm39) missense probably damaging 0.99
IGL02673:Insrr APN 3 87,720,368 (GRCm39) missense possibly damaging 0.95
IGL02724:Insrr APN 3 87,716,879 (GRCm39) missense probably benign 0.31
IGL02798:Insrr APN 3 87,717,824 (GRCm39) missense probably damaging 1.00
IGL02969:Insrr APN 3 87,721,498 (GRCm39) nonsense probably null
IGL03073:Insrr APN 3 87,717,245 (GRCm39) splice site probably benign
IGL03178:Insrr APN 3 87,709,848 (GRCm39) splice site probably null
IGL03389:Insrr APN 3 87,716,038 (GRCm39) missense probably damaging 1.00
IGL03399:Insrr APN 3 87,716,638 (GRCm39) missense probably null 0.99
IGL02799:Insrr UTSW 3 87,720,888 (GRCm39) missense probably damaging 1.00
R0011:Insrr UTSW 3 87,716,923 (GRCm39) missense possibly damaging 0.86
R0053:Insrr UTSW 3 87,707,759 (GRCm39) missense probably damaging 1.00
R0053:Insrr UTSW 3 87,707,759 (GRCm39) missense probably damaging 1.00
R0357:Insrr UTSW 3 87,715,953 (GRCm39) splice site probably null
R0501:Insrr UTSW 3 87,717,991 (GRCm39) missense probably benign 0.12
R0504:Insrr UTSW 3 87,720,463 (GRCm39) missense possibly damaging 0.69
R0522:Insrr UTSW 3 87,708,179 (GRCm39) missense probably damaging 1.00
R0555:Insrr UTSW 3 87,721,744 (GRCm39) splice site probably benign
R0558:Insrr UTSW 3 87,718,288 (GRCm39) missense possibly damaging 0.77
R0599:Insrr UTSW 3 87,720,440 (GRCm39) missense probably damaging 0.97
R1312:Insrr UTSW 3 87,707,797 (GRCm39) missense probably damaging 1.00
R1694:Insrr UTSW 3 87,711,369 (GRCm39) missense probably benign
R1785:Insrr UTSW 3 87,717,879 (GRCm39) splice site probably null
R1786:Insrr UTSW 3 87,717,879 (GRCm39) splice site probably null
R1892:Insrr UTSW 3 87,721,184 (GRCm39) missense probably damaging 1.00
R1950:Insrr UTSW 3 87,721,820 (GRCm39) missense probably damaging 1.00
R2080:Insrr UTSW 3 87,721,598 (GRCm39) missense possibly damaging 0.79
R2094:Insrr UTSW 3 87,710,488 (GRCm39) missense probably damaging 1.00
R2130:Insrr UTSW 3 87,717,879 (GRCm39) splice site probably null
R2131:Insrr UTSW 3 87,717,879 (GRCm39) splice site probably null
R2133:Insrr UTSW 3 87,717,879 (GRCm39) splice site probably null
R2220:Insrr UTSW 3 87,716,725 (GRCm39) missense probably damaging 1.00
R2259:Insrr UTSW 3 87,707,759 (GRCm39) missense probably damaging 1.00
R2404:Insrr UTSW 3 87,709,974 (GRCm39) missense possibly damaging 0.71
R4027:Insrr UTSW 3 87,716,906 (GRCm39) missense probably benign
R4042:Insrr UTSW 3 87,721,134 (GRCm39) missense probably damaging 1.00
R4510:Insrr UTSW 3 87,715,978 (GRCm39) missense possibly damaging 0.67
R4511:Insrr UTSW 3 87,715,978 (GRCm39) missense possibly damaging 0.67
R4571:Insrr UTSW 3 87,708,194 (GRCm39) missense probably benign
R4870:Insrr UTSW 3 87,718,911 (GRCm39) missense probably damaging 1.00
R5057:Insrr UTSW 3 87,722,572 (GRCm39) missense probably benign 0.00
R5393:Insrr UTSW 3 87,718,007 (GRCm39) splice site probably null
R5685:Insrr UTSW 3 87,707,803 (GRCm39) splice site probably null
R6039:Insrr UTSW 3 87,716,608 (GRCm39) missense possibly damaging 0.56
R6039:Insrr UTSW 3 87,716,608 (GRCm39) missense possibly damaging 0.56
R6047:Insrr UTSW 3 87,711,483 (GRCm39) missense probably damaging 1.00
R6276:Insrr UTSW 3 87,707,826 (GRCm39) nonsense probably null
R6298:Insrr UTSW 3 87,720,272 (GRCm39) missense probably damaging 1.00
R6726:Insrr UTSW 3 87,720,873 (GRCm39) missense probably damaging 1.00
R6727:Insrr UTSW 3 87,720,873 (GRCm39) missense probably damaging 1.00
R6728:Insrr UTSW 3 87,720,873 (GRCm39) missense probably damaging 1.00
R6796:Insrr UTSW 3 87,720,873 (GRCm39) missense probably damaging 1.00
R7041:Insrr UTSW 3 87,722,551 (GRCm39) missense probably damaging 1.00
R7169:Insrr UTSW 3 87,715,901 (GRCm39) missense probably benign 0.15
R7270:Insrr UTSW 3 87,710,440 (GRCm39) missense probably damaging 1.00
R7340:Insrr UTSW 3 87,721,623 (GRCm39) critical splice donor site probably null
R7398:Insrr UTSW 3 87,716,039 (GRCm39) missense probably damaging 1.00
R7473:Insrr UTSW 3 87,711,838 (GRCm39) splice site probably null
R7815:Insrr UTSW 3 87,716,002 (GRCm39) missense probably damaging 0.98
R8159:Insrr UTSW 3 87,707,735 (GRCm39) missense probably damaging 1.00
R8289:Insrr UTSW 3 87,721,501 (GRCm39) missense probably damaging 1.00
R8309:Insrr UTSW 3 87,717,749 (GRCm39) missense probably benign 0.00
R8312:Insrr UTSW 3 87,707,791 (GRCm39) missense possibly damaging 0.93
R8445:Insrr UTSW 3 87,720,891 (GRCm39) missense probably damaging 1.00
R8917:Insrr UTSW 3 87,718,276 (GRCm39) missense probably benign 0.00
R8989:Insrr UTSW 3 87,722,664 (GRCm39) missense probably damaging 0.96
R9015:Insrr UTSW 3 87,720,910 (GRCm39) missense probably damaging 1.00
R9202:Insrr UTSW 3 87,720,427 (GRCm39) missense probably damaging 1.00
R9251:Insrr UTSW 3 87,717,391 (GRCm39) missense probably benign 0.08
R9327:Insrr UTSW 3 87,721,604 (GRCm39) missense probably damaging 1.00
R9646:Insrr UTSW 3 87,721,805 (GRCm39) missense probably damaging 1.00
RF022:Insrr UTSW 3 87,711,792 (GRCm39) missense possibly damaging 0.51
Z1177:Insrr UTSW 3 87,708,134 (GRCm39) missense possibly damaging 0.91
Z1192:Insrr UTSW 3 87,709,886 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGACGCCTTTGTCCTGCC -3'
(R):5'- TCAGGATTTTAACCACAGTCCC -3'

Sequencing Primer
(F):5'- GTGTGAGCCTGTAGTTACCAAAATC -3'
(R):5'- GTCCCAACCCTGACCTGGATAATTC -3'
Posted On 2021-08-31