Incidental Mutation 'R8960:Insrr'
ID 682262
Institutional Source Beutler Lab
Gene Symbol Insrr
Ensembl Gene ENSMUSG00000005640
Gene Name insulin receptor-related receptor
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock # R8960 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 87796951-87816101 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 87813079 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 1008 (T1008K)
Ref Sequence ENSEMBL: ENSMUSP00000103208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029711] [ENSMUST00000029714] [ENSMUST00000090981] [ENSMUST00000107582]
AlphaFold Q9WTL4
Predicted Effect probably damaging
Transcript: ENSMUST00000029711
AA Change: T1008K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029711
Gene: ENSMUSG00000005640
AA Change: T1008K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Recep_L_domain 47 159 1.8e-25 PFAM
FU 225 268 9.54e-11 SMART
Pfam:Recep_L_domain 346 460 3.8e-28 PFAM
FN3 483 586 9.19e-1 SMART
FN3 605 798 6.45e-5 SMART
FN3 816 899 6.35e-4 SMART
TyrKc 979 1246 4.61e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029714
SMART Domains Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090981
SMART Domains Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107582
AA Change: T1008K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103208
Gene: ENSMUSG00000005640
AA Change: T1008K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Recep_L_domain 47 159 7.7e-25 PFAM
FU 225 268 9.54e-11 SMART
Pfam:Recep_L_domain 346 460 1.6e-28 PFAM
FN3 483 586 9.19e-1 SMART
FN3 605 798 6.45e-5 SMART
FN3 816 899 6.35e-4 SMART
TyrKc 979 1246 4.61e-128 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no anomalies in pancreatic islet morphology, beta-cell mass or pancreatic secretory function. This mutation in combination with Insr mutant mice does not affect the diabetes predisposition of Insr mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,012,983 E3548G probably damaging Het
Abcg4 G A 9: 44,274,766 Q603* probably null Het
Adar A G 3: 89,740,209 Y165C probably damaging Het
Afp A G 5: 90,503,641 T372A probably benign Het
Asah1 T A 8: 41,347,024 L184F probably damaging Het
Bpifb2 A T 2: 153,889,126 I206F possibly damaging Het
Btn1a1 C A 13: 23,464,571 D31Y possibly damaging Het
C4b T A 17: 34,733,918 D1110V probably damaging Het
Ccdc162 T A 10: 41,553,182 D1901V probably damaging Het
Cd101 A G 3: 101,003,501 V947A probably benign Het
Cd55b A T 1: 130,410,638 S238T possibly damaging Het
Cdc25c T C 18: 34,733,276 I437V possibly damaging Het
Cfap97 T C 8: 46,170,568 S332P probably damaging Het
Chpf A G 1: 75,475,754 L352P probably damaging Het
Cntln T A 4: 85,100,724 M1217K possibly damaging Het
Cntrl A G 2: 35,162,041 E1629G possibly damaging Het
Csnk1g2 T C 10: 80,638,562 Y206H probably damaging Het
Cyp2c55 T A 19: 39,007,103 W20R probably null Het
Dhx35 A T 2: 158,815,473 H130L possibly damaging Het
Dnm1 A G 2: 32,312,729 V54A probably damaging Het
Eea1 T A 10: 96,028,519 S967T probably benign Het
Elf3 A T 1: 135,255,075 I304N probably damaging Het
Eps8l1 G T 7: 4,478,215 R672L probably damaging Het
Fam129a A T 1: 151,715,712 H535L possibly damaging Het
Fam163a A T 1: 156,079,116 C96* probably null Het
Fam198b T C 3: 79,886,986 S254P probably benign Het
Fancd2 T C 6: 113,563,168 probably null Het
Fbxo3 C T 2: 104,027,929 L23F possibly damaging Het
Fbxw14 A G 9: 109,285,299 V121A possibly damaging Het
Fgd6 T A 10: 94,045,006 V574D probably benign Het
Gbp11 A G 5: 105,331,385 F124S probably damaging Het
Grm2 T G 9: 106,654,146 E48A probably benign Het
H2-M10.5 T A 17: 36,773,878 Y165N probably benign Het
Hoxa13 A C 6: 52,259,996 S172A probably benign Het
Ifih1 T A 2: 62,611,891 K376N possibly damaging Het
Itih1 A G 14: 30,933,457 S594P probably damaging Het
Kidins220 T C 12: 25,056,915 S1365P probably benign Het
Malrd1 A T 2: 15,565,430 K158* probably null Het
Man2c1 G A 9: 57,137,995 G504R probably damaging Het
Mbd1 T C 18: 74,273,819 probably null Het
Micall2 G A 5: 139,716,270 A323V probably benign Het
Mroh9 A C 1: 163,055,627 F428V probably benign Het
Obscn A T 11: 59,031,612 V6567E probably damaging Het
Olfr117 T A 17: 37,659,869 T155S probably benign Het
Olfr1389 A T 11: 49,430,716 Q80L probably benign Het
Olfr193 T A 16: 59,110,192 R139S probably benign Het
Olfr388-ps1 A C 11: 73,724,404 S207A unknown Het
Olfr393 A T 11: 73,847,341 C261* probably null Het
Olfr920 A T 9: 38,756,089 I134F possibly damaging Het
Pde4dip T C 3: 97,793,148 D238G probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Pgbd5 T A 8: 124,384,436 Y172F probably benign Het
Pkd1 A G 17: 24,576,202 T2288A probably damaging Het
Ppp6r2 T A 15: 89,253,036 M1K probably null Het
Rc3h1 A G 1: 160,946,594 T344A probably damaging Het
Rgs5 T C 1: 169,676,892 V37A possibly damaging Het
Rgs9 A G 11: 109,248,989 S17P possibly damaging Het
Rusc1 T A 3: 89,084,558 D407V probably damaging Het
Rwdd1 T A 10: 34,019,387 I18F possibly damaging Het
Satb2 C T 1: 56,871,311 probably null Het
Sds A G 5: 120,483,594 E267G probably damaging Het
Sema4b T A 7: 80,225,328 V822E probably damaging Het
Sfxn5 A T 6: 85,289,194 M107K probably damaging Het
Slc5a8 C T 10: 88,886,173 probably benign Het
Sorbs1 T C 19: 40,398,604 D6G probably damaging Het
Syt14 A C 1: 192,984,207 probably benign Het
Vmn2r124 T G 17: 18,063,029 Y328* probably null Het
Vmn2r86 T A 10: 130,453,803 E74D probably benign Het
Vmo1 A C 11: 70,513,650 L175W probably damaging Het
Vps13a G T 19: 16,705,883 L982I possibly damaging Het
Wdr19 T C 5: 65,240,868 V812A probably benign Het
Wdr27 T C 17: 14,883,646 I733V probably benign Het
Wdr54 A T 6: 83,155,757 H38Q probably damaging Het
Wdr76 G A 2: 121,510,623 V50I probably damaging Het
Zfp930 T A 8: 69,227,889 N59K probably damaging Het
Zfyve9 T C 4: 108,644,361 N1218S possibly damaging Het
Other mutations in Insrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Insrr APN 3 87813674 critical splice donor site probably null
IGL00801:Insrr APN 3 87813808 missense probably damaging 1.00
IGL01628:Insrr APN 3 87800792 nonsense probably null
IGL01755:Insrr APN 3 87814186 missense probably damaging 1.00
IGL02100:Insrr APN 3 87811620 missense probably damaging 1.00
IGL02261:Insrr APN 3 87800722 missense probably damaging 1.00
IGL02366:Insrr APN 3 87809909 missense possibly damaging 0.91
IGL02387:Insrr APN 3 87813127 missense probably damaging 1.00
IGL02478:Insrr APN 3 87809412 missense probably benign 0.14
IGL02550:Insrr APN 3 87804498 missense probably damaging 1.00
IGL02555:Insrr APN 3 87813817 missense probably damaging 0.99
IGL02673:Insrr APN 3 87813061 missense possibly damaging 0.95
IGL02724:Insrr APN 3 87809572 missense probably benign 0.31
IGL02798:Insrr APN 3 87810517 missense probably damaging 1.00
IGL02969:Insrr APN 3 87814191 nonsense probably null
IGL03073:Insrr APN 3 87809938 splice site probably benign
IGL03178:Insrr APN 3 87802541 splice site probably null
IGL03389:Insrr APN 3 87808731 missense probably damaging 1.00
IGL03399:Insrr APN 3 87809331 missense probably null 0.99
IGL02799:Insrr UTSW 3 87813581 missense probably damaging 1.00
R0011:Insrr UTSW 3 87809616 missense possibly damaging 0.86
R0053:Insrr UTSW 3 87800452 missense probably damaging 1.00
R0053:Insrr UTSW 3 87800452 missense probably damaging 1.00
R0357:Insrr UTSW 3 87808646 splice site probably null
R0501:Insrr UTSW 3 87810684 missense probably benign 0.12
R0504:Insrr UTSW 3 87813156 missense possibly damaging 0.69
R0522:Insrr UTSW 3 87800872 missense probably damaging 1.00
R0555:Insrr UTSW 3 87814437 splice site probably benign
R0558:Insrr UTSW 3 87810981 missense possibly damaging 0.77
R0599:Insrr UTSW 3 87813133 missense probably damaging 0.97
R1312:Insrr UTSW 3 87800490 missense probably damaging 1.00
R1694:Insrr UTSW 3 87804062 missense probably benign
R1785:Insrr UTSW 3 87810572 splice site probably null
R1786:Insrr UTSW 3 87810572 splice site probably null
R1892:Insrr UTSW 3 87813877 missense probably damaging 1.00
R1950:Insrr UTSW 3 87814513 missense probably damaging 1.00
R2080:Insrr UTSW 3 87814291 missense possibly damaging 0.79
R2094:Insrr UTSW 3 87803181 missense probably damaging 1.00
R2130:Insrr UTSW 3 87810572 splice site probably null
R2131:Insrr UTSW 3 87810572 splice site probably null
R2133:Insrr UTSW 3 87810572 splice site probably null
R2220:Insrr UTSW 3 87809418 missense probably damaging 1.00
R2259:Insrr UTSW 3 87800452 missense probably damaging 1.00
R2404:Insrr UTSW 3 87802667 missense possibly damaging 0.71
R4027:Insrr UTSW 3 87809599 missense probably benign
R4042:Insrr UTSW 3 87813827 missense probably damaging 1.00
R4510:Insrr UTSW 3 87808671 missense possibly damaging 0.67
R4511:Insrr UTSW 3 87808671 missense possibly damaging 0.67
R4571:Insrr UTSW 3 87800887 missense probably benign
R4870:Insrr UTSW 3 87811604 missense probably damaging 1.00
R5057:Insrr UTSW 3 87815265 missense probably benign 0.00
R5393:Insrr UTSW 3 87810700 splice site probably null
R5685:Insrr UTSW 3 87800496 splice site probably null
R6039:Insrr UTSW 3 87809301 missense possibly damaging 0.56
R6039:Insrr UTSW 3 87809301 missense possibly damaging 0.56
R6047:Insrr UTSW 3 87804176 missense probably damaging 1.00
R6276:Insrr UTSW 3 87800519 nonsense probably null
R6298:Insrr UTSW 3 87812965 missense probably damaging 1.00
R6726:Insrr UTSW 3 87813566 missense probably damaging 1.00
R6727:Insrr UTSW 3 87813566 missense probably damaging 1.00
R6728:Insrr UTSW 3 87813566 missense probably damaging 1.00
R6796:Insrr UTSW 3 87813566 missense probably damaging 1.00
R7041:Insrr UTSW 3 87815244 missense probably damaging 1.00
R7169:Insrr UTSW 3 87808594 missense probably benign 0.15
R7270:Insrr UTSW 3 87803133 missense probably damaging 1.00
R7340:Insrr UTSW 3 87814316 critical splice donor site probably null
R7398:Insrr UTSW 3 87808732 missense probably damaging 1.00
R7473:Insrr UTSW 3 87804531 splice site probably null
R7815:Insrr UTSW 3 87808695 missense probably damaging 0.98
R8159:Insrr UTSW 3 87800428 missense probably damaging 1.00
R8289:Insrr UTSW 3 87814194 missense probably damaging 1.00
R8309:Insrr UTSW 3 87810442 missense probably benign 0.00
R8312:Insrr UTSW 3 87800484 missense possibly damaging 0.93
R8445:Insrr UTSW 3 87813584 missense probably damaging 1.00
R8917:Insrr UTSW 3 87810969 missense probably benign 0.00
R8989:Insrr UTSW 3 87815357 missense probably damaging 0.96
R9015:Insrr UTSW 3 87813603 missense probably damaging 1.00
R9202:Insrr UTSW 3 87813120 missense probably damaging 1.00
R9251:Insrr UTSW 3 87810084 missense probably benign 0.08
R9327:Insrr UTSW 3 87814297 missense probably damaging 1.00
RF022:Insrr UTSW 3 87804485 missense possibly damaging 0.51
Z1177:Insrr UTSW 3 87800827 missense possibly damaging 0.91
Z1192:Insrr UTSW 3 87802579 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGACGCCTTTGTCCTGCC -3'
(R):5'- TCAGGATTTTAACCACAGTCCC -3'

Sequencing Primer
(F):5'- GTGTGAGCCTGTAGTTACCAAAATC -3'
(R):5'- GTCCCAACCCTGACCTGGATAATTC -3'
Posted On 2021-08-31