Incidental Mutation 'R8960:C4b'
ID 682311
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Name complement component 4B (Chido blood group)
Synonyms C4, Ss
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8960 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 34728380-34743882 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34733918 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 1110 (D1110V)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
AlphaFold P01029
Predicted Effect probably damaging
Transcript: ENSMUST00000069507
AA Change: D1110V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: D1110V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173057
SMART Domains Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
Pfam:A2M 1 62 6.5e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (78/78)
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,012,983 E3548G probably damaging Het
Abcg4 G A 9: 44,274,766 Q603* probably null Het
Adar A G 3: 89,740,209 Y165C probably damaging Het
Afp A G 5: 90,503,641 T372A probably benign Het
Asah1 T A 8: 41,347,024 L184F probably damaging Het
Bpifb2 A T 2: 153,889,126 I206F possibly damaging Het
Btn1a1 C A 13: 23,464,571 D31Y possibly damaging Het
Ccdc162 T A 10: 41,553,182 D1901V probably damaging Het
Cd101 A G 3: 101,003,501 V947A probably benign Het
Cd55b A T 1: 130,410,638 S238T possibly damaging Het
Cdc25c T C 18: 34,733,276 I437V possibly damaging Het
Cfap97 T C 8: 46,170,568 S332P probably damaging Het
Chpf A G 1: 75,475,754 L352P probably damaging Het
Cntln T A 4: 85,100,724 M1217K possibly damaging Het
Cntrl A G 2: 35,162,041 E1629G possibly damaging Het
Csnk1g2 T C 10: 80,638,562 Y206H probably damaging Het
Cyp2c55 T A 19: 39,007,103 W20R probably null Het
Dhx35 A T 2: 158,815,473 H130L possibly damaging Het
Dnm1 A G 2: 32,312,729 V54A probably damaging Het
Eea1 T A 10: 96,028,519 S967T probably benign Het
Elf3 A T 1: 135,255,075 I304N probably damaging Het
Eps8l1 G T 7: 4,478,215 R672L probably damaging Het
Fam129a A T 1: 151,715,712 H535L possibly damaging Het
Fam163a A T 1: 156,079,116 C96* probably null Het
Fam198b T C 3: 79,886,986 S254P probably benign Het
Fancd2 T C 6: 113,563,168 probably null Het
Fbxo3 C T 2: 104,027,929 L23F possibly damaging Het
Fbxw14 A G 9: 109,285,299 V121A possibly damaging Het
Fgd6 T A 10: 94,045,006 V574D probably benign Het
Gbp11 A G 5: 105,331,385 F124S probably damaging Het
Gm11639 A G 11: 104,929,946 probably benign Het
Grin1 A T 2: 25,305,416 probably benign Het
Grm2 T G 9: 106,654,146 E48A probably benign Het
H2-M10.5 T A 17: 36,773,878 Y165N probably benign Het
Hoxa13 A C 6: 52,259,996 S172A probably benign Het
Ifih1 T A 2: 62,611,891 K376N possibly damaging Het
Insrr C A 3: 87,813,079 T1008K probably damaging Het
Itih1 A G 14: 30,933,457 S594P probably damaging Het
Kidins220 T C 12: 25,056,915 S1365P probably benign Het
Malrd1 A T 2: 15,565,430 K158* probably null Het
Man2c1 G A 9: 57,137,995 G504R probably damaging Het
Mbd1 T C 18: 74,273,819 probably null Het
Micall2 G A 5: 139,716,270 A323V probably benign Het
Mroh9 A C 1: 163,055,627 F428V probably benign Het
Myo7b T A 18: 31,994,246 probably benign Het
Obscn A T 11: 59,031,612 V6567E probably damaging Het
Olfr117 T A 17: 37,659,869 T155S probably benign Het
Olfr1389 A T 11: 49,430,716 Q80L probably benign Het
Olfr193 T A 16: 59,110,192 R139S probably benign Het
Olfr388-ps1 A C 11: 73,724,404 S207A unknown Het
Olfr393 A T 11: 73,847,341 C261* probably null Het
Olfr920 A T 9: 38,756,089 I134F possibly damaging Het
Pde4dip T C 3: 97,793,148 D238G probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Pgbd5 T A 8: 124,384,436 Y172F probably benign Het
Pkd1 A G 17: 24,576,202 T2288A probably damaging Het
Ppp6r2 T A 15: 89,253,036 M1K probably null Het
Rc3h1 A G 1: 160,946,594 T344A probably damaging Het
Rgs5 T C 1: 169,676,892 V37A possibly damaging Het
Rgs9 A G 11: 109,248,989 S17P possibly damaging Het
Rusc1 T A 3: 89,084,558 D407V probably damaging Het
Rwdd1 T A 10: 34,019,387 I18F possibly damaging Het
Satb2 C T 1: 56,871,311 probably null Het
Sds A G 5: 120,483,594 E267G probably damaging Het
Sema4b T A 7: 80,225,328 V822E probably damaging Het
Sfxn5 A T 6: 85,289,194 M107K probably damaging Het
Slc5a8 C T 10: 88,886,173 probably benign Het
Sorbs1 T C 19: 40,398,604 D6G probably damaging Het
Syt14 A C 1: 192,984,207 probably benign Het
Vmn2r124 T G 17: 18,063,029 Y328* probably null Het
Vmn2r86 T A 10: 130,453,803 E74D probably benign Het
Vmo1 A C 11: 70,513,650 L175W probably damaging Het
Vps13a G T 19: 16,705,883 L982I possibly damaging Het
Wdr19 T C 5: 65,240,868 V812A probably benign Het
Wdr27 T C 17: 14,883,646 I733V probably benign Het
Wdr54 A T 6: 83,155,757 H38Q probably damaging Het
Wdr76 G A 2: 121,510,623 V50I probably damaging Het
Zfp930 T A 8: 69,227,889 N59K probably damaging Het
Zfyve9 T C 4: 108,644,361 N1218S possibly damaging Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34734428 missense probably damaging 1.00
IGL00433:C4b APN 17 34742041 missense possibly damaging 0.75
IGL00471:C4b APN 17 34734429 missense probably damaging 1.00
IGL00515:C4b APN 17 34728891 missense probably damaging 1.00
IGL01599:C4b APN 17 34743019 splice site probably benign
IGL01761:C4b APN 17 34739938 missense possibly damaging 0.56
IGL02004:C4b APN 17 34739010 unclassified probably benign
IGL02215:C4b APN 17 34734491 missense probably damaging 1.00
IGL02517:C4b APN 17 34734408 missense probably benign 0.01
IGL02926:C4b APN 17 34730712 missense possibly damaging 0.95
IGL03031:C4b APN 17 34731130 missense possibly damaging 0.47
IGL03057:C4b APN 17 34737764 unclassified probably benign
IGL03165:C4b APN 17 34739955 missense probably benign 0.13
IGL03380:C4b APN 17 34740286 missense probably benign 0.01
Aspiration UTSW 17 34734442 missense probably benign 0.00
Inspiration UTSW 17 34732166 splice site probably null
Peroration UTSW 17 34729399 critical splice donor site probably null
perspiration UTSW 17 34729831 missense probably damaging 1.00
FR4548:C4b UTSW 17 34740997 missense probably benign 0.00
PIT4142001:C4b UTSW 17 34733701 missense probably benign 0.01
R0064:C4b UTSW 17 34738856 missense probably damaging 1.00
R0113:C4b UTSW 17 34741240 missense probably damaging 0.98
R0143:C4b UTSW 17 34734219 unclassified probably benign
R0254:C4b UTSW 17 34734776 missense probably benign 0.00
R0320:C4b UTSW 17 34733161 missense probably benign 0.01
R0391:C4b UTSW 17 34735614 splice site probably benign
R0399:C4b UTSW 17 34728869 missense probably damaging 1.00
R0467:C4b UTSW 17 34736127 missense probably benign 0.01
R0549:C4b UTSW 17 34735415 missense probably damaging 1.00
R0561:C4b UTSW 17 34734417 missense probably damaging 0.99
R0662:C4b UTSW 17 34730888 missense probably damaging 1.00
R0941:C4b UTSW 17 34740055 missense probably benign
R1161:C4b UTSW 17 34729593 missense probably damaging 1.00
R1169:C4b UTSW 17 34742972 missense probably benign 0.14
R1186:C4b UTSW 17 34736309 missense possibly damaging 0.47
R1310:C4b UTSW 17 34729593 missense probably damaging 1.00
R1398:C4b UTSW 17 34730719 unclassified probably benign
R1472:C4b UTSW 17 34743769 nonsense probably null
R1496:C4b UTSW 17 34740021 missense probably benign 0.30
R1544:C4b UTSW 17 34738967 missense probably benign 0.13
R1588:C4b UTSW 17 34741025 missense probably benign
R1645:C4b UTSW 17 34740597 missense probably damaging 1.00
R1664:C4b UTSW 17 34732978 missense probably damaging 1.00
R1678:C4b UTSW 17 34743650 missense probably benign 0.05
R1710:C4b UTSW 17 34743664 splice site probably benign
R1713:C4b UTSW 17 34729271 splice site probably benign
R1770:C4b UTSW 17 34736927 missense possibly damaging 0.78
R1859:C4b UTSW 17 34735553 missense probably benign
R1924:C4b UTSW 17 34729657 missense probably damaging 1.00
R2057:C4b UTSW 17 34728620 missense probably damaging 1.00
R2060:C4b UTSW 17 34736101 missense probably damaging 1.00
R2184:C4b UTSW 17 34737702 missense probably benign 0.27
R2306:C4b UTSW 17 34728518 missense probably benign 0.00
R2363:C4b UTSW 17 34736058 splice site probably benign
R2365:C4b UTSW 17 34736058 splice site probably benign
R2379:C4b UTSW 17 34735743 missense possibly damaging 0.81
R2860:C4b UTSW 17 34734758 missense probably damaging 0.99
R2861:C4b UTSW 17 34734758 missense probably damaging 0.99
R3551:C4b UTSW 17 34741872 missense possibly damaging 0.75
R3765:C4b UTSW 17 34729840 missense probably damaging 0.98
R4157:C4b UTSW 17 34742855 missense probably damaging 1.00
R4299:C4b UTSW 17 34731144 missense possibly damaging 0.52
R4365:C4b UTSW 17 34734743 missense possibly damaging 0.65
R4411:C4b UTSW 17 34728864 missense probably damaging 1.00
R4613:C4b UTSW 17 34734551 missense probably benign 0.12
R4784:C4b UTSW 17 34733406 missense probably benign 0.00
R4790:C4b UTSW 17 34734143 missense probably benign 0.01
R4831:C4b UTSW 17 34736890 splice site probably null
R4879:C4b UTSW 17 34743647 missense probably damaging 0.99
R5036:C4b UTSW 17 34740445 critical splice acceptor site probably null
R5361:C4b UTSW 17 34741238 missense probably benign 0.15
R5384:C4b UTSW 17 34737661 missense possibly damaging 0.89
R5518:C4b UTSW 17 34734442 missense probably benign 0.00
R5590:C4b UTSW 17 34740335 missense probably damaging 0.98
R5643:C4b UTSW 17 34742417 missense probably benign 0.01
R5644:C4b UTSW 17 34742417 missense probably benign 0.01
R5833:C4b UTSW 17 34730673 missense probably damaging 1.00
R5931:C4b UTSW 17 34729193 missense probably damaging 0.99
R6178:C4b UTSW 17 34733406 missense probably benign 0.00
R6209:C4b UTSW 17 34741087 missense possibly damaging 0.93
R6225:C4b UTSW 17 34738874 missense possibly damaging 0.64
R6518:C4b UTSW 17 34734205 missense probably damaging 0.98
R6613:C4b UTSW 17 34733565 missense probably damaging 0.99
R6781:C4b UTSW 17 34742954 missense probably damaging 0.99
R6807:C4b UTSW 17 34730956 missense probably benign 0.17
R6858:C4b UTSW 17 34729831 missense probably damaging 1.00
R6962:C4b UTSW 17 34732166 splice site probably null
R7068:C4b UTSW 17 34733477 missense probably damaging 1.00
R7081:C4b UTSW 17 34735443 missense probably benign 0.27
R7105:C4b UTSW 17 34730911 missense possibly damaging 0.52
R7211:C4b UTSW 17 34735534 missense possibly damaging 0.92
R7296:C4b UTSW 17 34743659 missense probably damaging 1.00
R7314:C4b UTSW 17 34740356 missense probably benign
R7330:C4b UTSW 17 34730472 missense probably damaging 1.00
R7397:C4b UTSW 17 34742390 missense possibly damaging 0.80
R7437:C4b UTSW 17 34734733 missense probably benign 0.10
R7490:C4b UTSW 17 34731080 nonsense probably null
R7597:C4b UTSW 17 34739675 missense probably benign
R7633:C4b UTSW 17 34729399 critical splice donor site probably null
R7900:C4b UTSW 17 34739777 missense probably benign 0.03
R7910:C4b UTSW 17 34740352 missense probably benign 0.00
R7923:C4b UTSW 17 34742380 missense probably damaging 1.00
R7960:C4b UTSW 17 34741278 splice site probably null
R8420:C4b UTSW 17 34734539 missense probably damaging 0.97
R8467:C4b UTSW 17 34732813 missense possibly damaging 0.51
R8558:C4b UTSW 17 34736567 missense probably damaging 1.00
R8725:C4b UTSW 17 34734485 missense probably damaging 1.00
R8727:C4b UTSW 17 34734485 missense probably damaging 1.00
R8853:C4b UTSW 17 34729905 missense possibly damaging 0.91
R8934:C4b UTSW 17 34732984 missense possibly damaging 0.78
R8944:C4b UTSW 17 34742939 missense probably benign 0.00
R8982:C4b UTSW 17 34734364 critical splice donor site probably null
R9104:C4b UTSW 17 34729259 missense probably benign 0.39
R9114:C4b UTSW 17 34729430 missense probably damaging 0.99
R9348:C4b UTSW 17 34733185 missense probably benign 0.01
R9428:C4b UTSW 17 34730911 missense possibly damaging 0.52
R9533:C4b UTSW 17 34737724 nonsense probably null
R9591:C4b UTSW 17 34738955 missense probably benign 0.00
R9678:C4b UTSW 17 34741789 critical splice donor site probably null
Z1176:C4b UTSW 17 34731147 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATGACCACAAAGGCGGTCAG -3'
(R):5'- CTCCTTTGGGGCTTGGTTACAC -3'

Sequencing Primer
(F):5'- AGTGCCACTGTCTCGTCAG -3'
(R):5'- TTGGTTACACCGGGACAGCAG -3'
Posted On 2021-08-31