Incidental Mutation 'R8961:Unc13c'
ID 682348
Institutional Source Beutler Lab
Gene Symbol Unc13c
Ensembl Gene ENSMUSG00000062151
Gene Name unc-13 homolog C
Synonyms D9Ertd414e, 1500037O19Rik, Munc13-3, Unc13h3
MMRRC Submission 068795-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8961 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 73386704-73876248 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 73839524 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 442 (N442K)
Ref Sequence ENSEMBL: ENSMUSP00000139027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075245] [ENSMUST00000184666]
AlphaFold Q8K0T7
Predicted Effect probably benign
Transcript: ENSMUST00000075245
AA Change: N442K

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000074726
Gene: ENSMUSG00000062151
AA Change: N442K

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1883 2023 2.6e-50 PFAM
C2 2058 2164 4.15e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184666
AA Change: N442K

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000139027
Gene: ENSMUSG00000062151
AA Change: N442K

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1882 2024 8.3e-59 PFAM
C2 2058 2164 4.15e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Homozygous mutant mice demonstrate an impaired ability to learn complex motor tasks, putatively due to an observed increase in paired-pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700064H15Rik T A 3: 19,664,633 (GRCm39) probably benign Het
Angptl6 T C 9: 20,789,467 (GRCm39) T142A probably benign Het
Atp6v1b2 A G 8: 69,555,414 (GRCm39) I202V probably benign Het
B3gat2 A T 1: 23,801,900 (GRCm39) D62V probably benign Het
Ccdc180 A G 4: 45,929,573 (GRCm39) D1211G possibly damaging Het
Ccp110 T G 7: 118,322,110 (GRCm39) D588E probably damaging Het
Cdh6 A T 15: 13,041,447 (GRCm39) I539K probably benign Het
Chd5 A G 4: 152,467,489 (GRCm39) probably benign Het
Crim1 T C 17: 78,680,117 (GRCm39) S953P possibly damaging Het
Dennd2a T C 6: 39,462,555 (GRCm39) K652E probably damaging Het
Dnajb3 T A 1: 88,132,998 (GRCm39) R135* probably null Het
Dnajc25 T A 4: 59,020,438 (GRCm39) M168K Het
Elfn2 T C 15: 78,557,378 (GRCm39) S390G probably benign Het
Ephb6 C T 6: 41,590,293 (GRCm39) A15V probably benign Het
Fam135b T A 15: 71,404,812 (GRCm39) N78I probably damaging Het
Flot2 G A 11: 77,945,632 (GRCm39) probably benign Het
Gm10277 T A 11: 77,677,826 (GRCm39) probably benign Het
Itpr1 T C 6: 108,470,666 (GRCm39) V2198A possibly damaging Het
Kndc1 T A 7: 139,503,976 (GRCm39) F1093L possibly damaging Het
Kndc1 C T 7: 139,507,708 (GRCm39) S1222F possibly damaging Het
Kpna4 T C 3: 68,986,821 (GRCm39) T523A probably benign Het
Krt39 T C 11: 99,409,931 (GRCm39) D202G possibly damaging Het
Loxhd1 C T 18: 77,472,765 (GRCm39) T985M probably damaging Het
Mdc1 T C 17: 36,159,407 (GRCm39) S596P probably benign Het
Misp A G 10: 79,663,823 (GRCm39) Q599R probably benign Het
Mogs C A 6: 83,092,720 (GRCm39) F53L probably benign Het
Mthfr A T 4: 148,128,099 (GRCm39) N167Y probably damaging Het
Nod1 C T 6: 54,926,461 (GRCm39) E53K probably damaging Het
Or1j11 A T 2: 36,312,177 (GRCm39) I256F probably damaging Het
Or52l1 A G 7: 104,830,376 (GRCm39) I48T possibly damaging Het
Or5m5 T A 2: 85,814,610 (GRCm39) M142K probably damaging Het
Or6c5c C T 10: 129,299,225 (GRCm39) P227S probably damaging Het
Or6z5 T C 7: 6,477,763 (GRCm39) V218A probably benign Het
Pkd1l2 A G 8: 117,726,717 (GRCm39) I2263T possibly damaging Het
Rbbp8 T C 18: 11,865,262 (GRCm39) M717T probably benign Het
Rest A G 5: 77,416,482 (GRCm39) H232R probably damaging Het
Rps6ka1 A G 4: 133,587,362 (GRCm39) probably null Het
Rtf1 T A 2: 119,557,377 (GRCm39) F465I probably benign Het
Skil T C 3: 31,167,729 (GRCm39) S454P probably benign Het
Snx13 T C 12: 35,155,285 (GRCm39) Y450H probably damaging Het
Spef2 T A 15: 9,647,414 (GRCm39) E971V possibly damaging Het
Sqle T A 15: 59,187,695 (GRCm39) M1K probably null Het
Srcap C G 7: 127,141,101 (GRCm39) P1566R probably damaging Het
Stxbp5l ATTTT ATTTTT 16: 37,036,414 (GRCm39) probably null Het
Tmc3 T C 7: 83,256,970 (GRCm39) Y408H probably damaging Het
Uba2 A T 7: 33,855,642 (GRCm39) probably benign Het
Vmn1r21 T A 6: 57,820,829 (GRCm39) H205L probably damaging Het
Vwa7 C T 17: 35,238,086 (GRCm39) T229I probably damaging Het
Washc4 A G 10: 83,409,657 (GRCm39) D602G probably damaging Het
Zcchc9 C A 13: 91,953,955 (GRCm39) probably benign Het
Other mutations in Unc13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Unc13c APN 9 73,643,985 (GRCm39) missense probably damaging 0.99
IGL00693:Unc13c APN 9 73,665,884 (GRCm39) missense probably benign 0.18
IGL01022:Unc13c APN 9 73,424,610 (GRCm39) missense probably benign 0.06
IGL01088:Unc13c APN 9 73,839,563 (GRCm39) missense possibly damaging 0.63
IGL01123:Unc13c APN 9 73,840,479 (GRCm39) missense probably benign 0.05
IGL01131:Unc13c APN 9 73,471,335 (GRCm39) missense probably benign
IGL01135:Unc13c APN 9 73,392,175 (GRCm39) missense probably damaging 1.00
IGL01393:Unc13c APN 9 73,447,552 (GRCm39) missense probably benign 0.06
IGL01752:Unc13c APN 9 73,839,093 (GRCm39) missense probably benign 0.01
IGL01893:Unc13c APN 9 73,600,648 (GRCm39) missense probably benign 0.15
IGL01897:Unc13c APN 9 73,453,309 (GRCm39) missense probably damaging 0.99
IGL01936:Unc13c APN 9 73,600,524 (GRCm39) missense probably benign 0.07
IGL02122:Unc13c APN 9 73,641,679 (GRCm39) splice site probably benign
IGL02341:Unc13c APN 9 73,840,492 (GRCm39) missense possibly damaging 0.76
IGL02434:Unc13c APN 9 73,839,910 (GRCm39) missense probably benign 0.01
IGL02545:Unc13c APN 9 73,388,357 (GRCm39) missense probably damaging 0.98
IGL02709:Unc13c APN 9 73,466,238 (GRCm39) missense probably benign 0.00
IGL02815:Unc13c APN 9 73,447,545 (GRCm39) missense possibly damaging 0.83
IGL02904:Unc13c APN 9 73,388,349 (GRCm39) nonsense probably null
IGL03117:Unc13c APN 9 73,441,307 (GRCm39) missense probably benign 0.03
IGL03260:Unc13c APN 9 73,838,626 (GRCm39) missense probably benign 0.11
Feeling UTSW 9 73,600,553 (GRCm39) missense possibly damaging 0.46
Inkling UTSW 9 73,839,126 (GRCm39) missense probably damaging 1.00
notion UTSW 9 73,643,844 (GRCm39) missense probably damaging 1.00
BB001:Unc13c UTSW 9 73,641,690 (GRCm39) missense probably benign 0.05
BB011:Unc13c UTSW 9 73,641,690 (GRCm39) missense probably benign 0.05
PIT4431001:Unc13c UTSW 9 73,656,829 (GRCm39) missense probably damaging 0.99
PIT4651001:Unc13c UTSW 9 73,391,021 (GRCm39) missense possibly damaging 0.48
R0017:Unc13c UTSW 9 73,600,583 (GRCm39) missense probably benign 0.07
R0039:Unc13c UTSW 9 73,576,847 (GRCm39) splice site probably benign
R0164:Unc13c UTSW 9 73,602,174 (GRCm39) missense probably benign 0.01
R0164:Unc13c UTSW 9 73,602,174 (GRCm39) missense probably benign 0.01
R0308:Unc13c UTSW 9 73,388,400 (GRCm39) missense probably benign 0.04
R0344:Unc13c UTSW 9 73,838,067 (GRCm39) missense probably benign 0.39
R0421:Unc13c UTSW 9 73,840,492 (GRCm39) missense possibly damaging 0.76
R0606:Unc13c UTSW 9 73,438,265 (GRCm39) splice site probably benign
R0655:Unc13c UTSW 9 73,838,235 (GRCm39) missense probably damaging 0.96
R1013:Unc13c UTSW 9 73,840,614 (GRCm39) missense probably benign 0.45
R1293:Unc13c UTSW 9 73,481,356 (GRCm39) missense probably benign 0.06
R1493:Unc13c UTSW 9 73,546,350 (GRCm39) missense probably benign 0.27
R1675:Unc13c UTSW 9 73,546,332 (GRCm39) critical splice donor site probably null
R1789:Unc13c UTSW 9 73,663,621 (GRCm39) missense possibly damaging 0.92
R2001:Unc13c UTSW 9 73,390,897 (GRCm39) splice site probably null
R2055:Unc13c UTSW 9 73,643,832 (GRCm39) missense probably damaging 1.00
R2060:Unc13c UTSW 9 73,572,938 (GRCm39) missense probably damaging 0.99
R2420:Unc13c UTSW 9 73,838,829 (GRCm39) missense probably damaging 0.97
R2421:Unc13c UTSW 9 73,838,829 (GRCm39) missense probably damaging 0.97
R2422:Unc13c UTSW 9 73,838,829 (GRCm39) missense probably damaging 0.97
R3415:Unc13c UTSW 9 73,839,868 (GRCm39) missense probably benign 0.00
R3423:Unc13c UTSW 9 73,837,935 (GRCm39) missense possibly damaging 0.46
R3820:Unc13c UTSW 9 73,838,240 (GRCm39) missense probably benign 0.00
R3857:Unc13c UTSW 9 73,606,390 (GRCm39) nonsense probably null
R3859:Unc13c UTSW 9 73,606,390 (GRCm39) nonsense probably null
R3895:Unc13c UTSW 9 73,840,805 (GRCm39) missense probably benign
R4038:Unc13c UTSW 9 73,441,188 (GRCm39) critical splice donor site probably null
R4077:Unc13c UTSW 9 73,643,821 (GRCm39) nonsense probably null
R4125:Unc13c UTSW 9 73,481,289 (GRCm39) critical splice donor site probably null
R4128:Unc13c UTSW 9 73,641,819 (GRCm39) missense probably damaging 1.00
R4235:Unc13c UTSW 9 73,438,234 (GRCm39) missense possibly damaging 0.68
R4295:Unc13c UTSW 9 73,641,786 (GRCm39) missense probably damaging 1.00
R4307:Unc13c UTSW 9 73,600,649 (GRCm39) missense probably benign 0.06
R4658:Unc13c UTSW 9 73,840,108 (GRCm39) missense probably damaging 1.00
R4694:Unc13c UTSW 9 73,479,636 (GRCm39) missense probably benign 0.00
R4735:Unc13c UTSW 9 73,600,620 (GRCm39) missense probably benign 0.00
R4744:Unc13c UTSW 9 73,839,126 (GRCm39) missense probably damaging 1.00
R4795:Unc13c UTSW 9 73,839,469 (GRCm39) missense probably damaging 0.97
R4827:Unc13c UTSW 9 73,838,568 (GRCm39) missense probably damaging 1.00
R4838:Unc13c UTSW 9 73,839,354 (GRCm39) missense possibly damaging 0.68
R4869:Unc13c UTSW 9 73,587,716 (GRCm39) missense probably benign 0.02
R4873:Unc13c UTSW 9 73,424,566 (GRCm39) missense probably damaging 0.98
R4875:Unc13c UTSW 9 73,424,566 (GRCm39) missense probably damaging 0.98
R4876:Unc13c UTSW 9 73,656,821 (GRCm39) missense probably damaging 1.00
R4905:Unc13c UTSW 9 73,587,674 (GRCm39) missense probably benign
R4912:Unc13c UTSW 9 73,481,304 (GRCm39) missense probably damaging 0.99
R5026:Unc13c UTSW 9 73,838,185 (GRCm39) missense possibly damaging 0.74
R5127:Unc13c UTSW 9 73,840,654 (GRCm39) missense probably benign 0.26
R5151:Unc13c UTSW 9 73,838,757 (GRCm39) missense probably benign 0.02
R5171:Unc13c UTSW 9 73,665,236 (GRCm39) missense probably benign
R5244:Unc13c UTSW 9 73,433,233 (GRCm39) critical splice donor site probably null
R5342:Unc13c UTSW 9 73,838,105 (GRCm39) missense probably benign 0.00
R5399:Unc13c UTSW 9 73,656,970 (GRCm39) missense possibly damaging 0.95
R5409:Unc13c UTSW 9 73,485,672 (GRCm39) missense possibly damaging 0.78
R5460:Unc13c UTSW 9 73,453,271 (GRCm39) missense probably benign
R5680:Unc13c UTSW 9 73,839,884 (GRCm39) missense probably damaging 1.00
R5681:Unc13c UTSW 9 73,453,357 (GRCm39) splice site probably null
R5728:Unc13c UTSW 9 73,466,238 (GRCm39) missense probably benign 0.01
R5762:Unc13c UTSW 9 73,719,649 (GRCm39) missense probably benign 0.00
R5764:Unc13c UTSW 9 73,441,185 (GRCm39) splice site probably null
R5829:Unc13c UTSW 9 73,600,650 (GRCm39) missense probably benign 0.15
R5894:Unc13c UTSW 9 73,600,486 (GRCm39) critical splice donor site probably null
R5936:Unc13c UTSW 9 73,485,774 (GRCm39) missense probably damaging 1.00
R6043:Unc13c UTSW 9 73,643,933 (GRCm39) missense possibly damaging 0.88
R6046:Unc13c UTSW 9 73,838,166 (GRCm39) missense probably benign
R6148:Unc13c UTSW 9 73,600,648 (GRCm39) missense probably benign 0.15
R6207:Unc13c UTSW 9 73,665,910 (GRCm39) missense possibly damaging 0.89
R6277:Unc13c UTSW 9 73,606,451 (GRCm39) missense probably damaging 1.00
R6338:Unc13c UTSW 9 73,641,729 (GRCm39) missense probably damaging 0.99
R6615:Unc13c UTSW 9 73,837,890 (GRCm39) missense possibly damaging 0.63
R6978:Unc13c UTSW 9 73,839,259 (GRCm39) missense probably benign 0.39
R7053:Unc13c UTSW 9 73,839,579 (GRCm39) missense probably damaging 1.00
R7223:Unc13c UTSW 9 73,536,473 (GRCm39) missense probably benign 0.44
R7259:Unc13c UTSW 9 73,424,645 (GRCm39) missense probably benign 0.00
R7353:Unc13c UTSW 9 73,481,355 (GRCm39) missense probably benign 0.00
R7357:Unc13c UTSW 9 73,840,811 (GRCm39) small insertion probably benign
R7357:Unc13c UTSW 9 73,840,810 (GRCm39) small insertion probably benign
R7607:Unc13c UTSW 9 73,576,817 (GRCm39) missense probably damaging 0.98
R7626:Unc13c UTSW 9 73,641,799 (GRCm39) missense probably damaging 1.00
R7639:Unc13c UTSW 9 73,840,450 (GRCm39) missense probably damaging 0.99
R7657:Unc13c UTSW 9 73,441,185 (GRCm39) splice site probably null
R7665:Unc13c UTSW 9 73,587,756 (GRCm39) missense probably benign 0.28
R7704:Unc13c UTSW 9 73,606,494 (GRCm39) missense probably benign 0.27
R7776:Unc13c UTSW 9 73,602,232 (GRCm39) missense probably damaging 1.00
R7811:Unc13c UTSW 9 73,600,553 (GRCm39) missense possibly damaging 0.46
R7833:Unc13c UTSW 9 73,388,391 (GRCm39) missense possibly damaging 0.53
R7839:Unc13c UTSW 9 73,840,596 (GRCm39) missense possibly damaging 0.63
R7869:Unc13c UTSW 9 73,602,159 (GRCm39) missense probably damaging 1.00
R7924:Unc13c UTSW 9 73,641,690 (GRCm39) missense probably benign 0.05
R8047:Unc13c UTSW 9 73,719,636 (GRCm39) nonsense probably null
R8167:Unc13c UTSW 9 73,643,985 (GRCm39) missense probably damaging 0.99
R8202:Unc13c UTSW 9 73,643,844 (GRCm39) missense probably damaging 1.00
R8210:Unc13c UTSW 9 73,392,220 (GRCm39) missense probably benign 0.13
R8352:Unc13c UTSW 9 73,838,290 (GRCm39) missense probably damaging 0.99
R8368:Unc13c UTSW 9 73,838,070 (GRCm39) missense probably benign 0.15
R8452:Unc13c UTSW 9 73,838,290 (GRCm39) missense probably damaging 0.99
R8535:Unc13c UTSW 9 73,447,653 (GRCm39) missense probably benign
R8677:Unc13c UTSW 9 73,840,243 (GRCm39) missense probably benign 0.00
R8700:Unc13c UTSW 9 73,479,679 (GRCm39) missense probably benign 0.44
R8848:Unc13c UTSW 9 73,433,263 (GRCm39) missense probably benign
R8902:Unc13c UTSW 9 73,656,830 (GRCm39) missense probably damaging 0.97
R8953:Unc13c UTSW 9 73,840,044 (GRCm39) missense probably benign 0.00
R9015:Unc13c UTSW 9 73,453,322 (GRCm39) missense probably benign
R9114:Unc13c UTSW 9 73,719,665 (GRCm39) missense probably benign 0.02
R9217:Unc13c UTSW 9 73,485,715 (GRCm39) missense probably damaging 1.00
R9252:Unc13c UTSW 9 73,424,553 (GRCm39) missense possibly damaging 0.80
R9273:Unc13c UTSW 9 73,839,862 (GRCm39) missense possibly damaging 0.96
R9317:Unc13c UTSW 9 73,447,662 (GRCm39) missense possibly damaging 0.88
R9412:Unc13c UTSW 9 73,839,772 (GRCm39) missense probably benign
R9505:Unc13c UTSW 9 73,838,824 (GRCm39) missense probably benign 0.22
R9516:Unc13c UTSW 9 73,392,220 (GRCm39) missense probably damaging 0.99
R9528:Unc13c UTSW 9 73,837,960 (GRCm39) missense possibly damaging 0.48
R9567:Unc13c UTSW 9 73,536,485 (GRCm39) missense probably damaging 0.99
R9756:Unc13c UTSW 9 73,839,526 (GRCm39) missense probably benign 0.23
R9783:Unc13c UTSW 9 73,392,227 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCCACATAGTGAGGTGTTTGC -3'
(R):5'- TTGAAACCCCTCAGCAAAGG -3'

Sequencing Primer
(F):5'- CCACATAGTGAGGTGTTTGCTTTTC -3'
(R):5'- CCTCAGCAAAGGGATTCTGTC -3'
Posted On 2021-08-31