Incidental Mutation 'R8961:Washc4'
ID 682350
Institutional Source Beutler Lab
Gene Symbol Washc4
Ensembl Gene ENSMUSG00000034560
Gene Name WASH complex subunit 4
Synonyms A230046K03Rik
MMRRC Submission 068795-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.956) question?
Stock # R8961 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 83379616-83432337 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 83409657 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 602 (D602G)
Ref Sequence ENSEMBL: ENSMUSP00000039322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038388] [ENSMUST00000217842]
AlphaFold Q3UMB9
Predicted Effect probably damaging
Transcript: ENSMUST00000038388
AA Change: D602G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000039322
Gene: ENSMUSG00000034560
AA Change: D602G

DomainStartEndE-ValueType
Pfam:WASH-7_N 32 604 4.8e-245 PFAM
Pfam:WASH-7_mid 605 949 7.9e-176 PFAM
low complexity region 954 965 N/A INTRINSIC
Pfam:WASH-7_C 966 1135 9.1e-76 PFAM
low complexity region 1138 1156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217842
Meta Mutation Damage Score 0.3184 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the WASH complex, which functions in the intracellular transport of endosomes. Mutations in this gene have been detected in individuals with autosomal recessive mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700064H15Rik T A 3: 19,664,633 (GRCm39) probably benign Het
Angptl6 T C 9: 20,789,467 (GRCm39) T142A probably benign Het
Atp6v1b2 A G 8: 69,555,414 (GRCm39) I202V probably benign Het
B3gat2 A T 1: 23,801,900 (GRCm39) D62V probably benign Het
Ccdc180 A G 4: 45,929,573 (GRCm39) D1211G possibly damaging Het
Ccp110 T G 7: 118,322,110 (GRCm39) D588E probably damaging Het
Cdh6 A T 15: 13,041,447 (GRCm39) I539K probably benign Het
Chd5 A G 4: 152,467,489 (GRCm39) probably benign Het
Crim1 T C 17: 78,680,117 (GRCm39) S953P possibly damaging Het
Dennd2a T C 6: 39,462,555 (GRCm39) K652E probably damaging Het
Dnajb3 T A 1: 88,132,998 (GRCm39) R135* probably null Het
Dnajc25 T A 4: 59,020,438 (GRCm39) M168K Het
Elfn2 T C 15: 78,557,378 (GRCm39) S390G probably benign Het
Ephb6 C T 6: 41,590,293 (GRCm39) A15V probably benign Het
Fam135b T A 15: 71,404,812 (GRCm39) N78I probably damaging Het
Flot2 G A 11: 77,945,632 (GRCm39) probably benign Het
Gm10277 T A 11: 77,677,826 (GRCm39) probably benign Het
Itpr1 T C 6: 108,470,666 (GRCm39) V2198A possibly damaging Het
Kndc1 T A 7: 139,503,976 (GRCm39) F1093L possibly damaging Het
Kndc1 C T 7: 139,507,708 (GRCm39) S1222F possibly damaging Het
Kpna4 T C 3: 68,986,821 (GRCm39) T523A probably benign Het
Krt39 T C 11: 99,409,931 (GRCm39) D202G possibly damaging Het
Loxhd1 C T 18: 77,472,765 (GRCm39) T985M probably damaging Het
Mdc1 T C 17: 36,159,407 (GRCm39) S596P probably benign Het
Misp A G 10: 79,663,823 (GRCm39) Q599R probably benign Het
Mogs C A 6: 83,092,720 (GRCm39) F53L probably benign Het
Mthfr A T 4: 148,128,099 (GRCm39) N167Y probably damaging Het
Nod1 C T 6: 54,926,461 (GRCm39) E53K probably damaging Het
Or1j11 A T 2: 36,312,177 (GRCm39) I256F probably damaging Het
Or52l1 A G 7: 104,830,376 (GRCm39) I48T possibly damaging Het
Or5m5 T A 2: 85,814,610 (GRCm39) M142K probably damaging Het
Or6c5c C T 10: 129,299,225 (GRCm39) P227S probably damaging Het
Or6z5 T C 7: 6,477,763 (GRCm39) V218A probably benign Het
Pkd1l2 A G 8: 117,726,717 (GRCm39) I2263T possibly damaging Het
Rbbp8 T C 18: 11,865,262 (GRCm39) M717T probably benign Het
Rest A G 5: 77,416,482 (GRCm39) H232R probably damaging Het
Rps6ka1 A G 4: 133,587,362 (GRCm39) probably null Het
Rtf1 T A 2: 119,557,377 (GRCm39) F465I probably benign Het
Skil T C 3: 31,167,729 (GRCm39) S454P probably benign Het
Snx13 T C 12: 35,155,285 (GRCm39) Y450H probably damaging Het
Spef2 T A 15: 9,647,414 (GRCm39) E971V possibly damaging Het
Sqle T A 15: 59,187,695 (GRCm39) M1K probably null Het
Srcap C G 7: 127,141,101 (GRCm39) P1566R probably damaging Het
Stxbp5l ATTTT ATTTTT 16: 37,036,414 (GRCm39) probably null Het
Tmc3 T C 7: 83,256,970 (GRCm39) Y408H probably damaging Het
Uba2 A T 7: 33,855,642 (GRCm39) probably benign Het
Unc13c G T 9: 73,839,524 (GRCm39) N442K probably benign Het
Vmn1r21 T A 6: 57,820,829 (GRCm39) H205L probably damaging Het
Vwa7 C T 17: 35,238,086 (GRCm39) T229I probably damaging Het
Zcchc9 C A 13: 91,953,955 (GRCm39) probably benign Het
Other mutations in Washc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Washc4 APN 10 83,386,747 (GRCm39) missense probably benign 0.07
IGL01370:Washc4 APN 10 83,394,694 (GRCm39) missense probably damaging 0.98
IGL01524:Washc4 APN 10 83,411,996 (GRCm39) missense probably benign 0.37
IGL01682:Washc4 APN 10 83,416,170 (GRCm39) missense possibly damaging 0.93
IGL01973:Washc4 APN 10 83,391,973 (GRCm39) missense probably damaging 0.99
IGL02002:Washc4 APN 10 83,415,407 (GRCm39) missense possibly damaging 0.95
IGL02020:Washc4 APN 10 83,400,336 (GRCm39) missense probably damaging 0.97
IGL02230:Washc4 APN 10 83,417,233 (GRCm39) missense probably benign 0.00
IGL02421:Washc4 APN 10 83,415,414 (GRCm39) missense probably damaging 0.98
IGL02514:Washc4 APN 10 83,405,947 (GRCm39) missense probably damaging 0.98
IGL02619:Washc4 APN 10 83,394,717 (GRCm39) missense possibly damaging 0.84
IGL02852:Washc4 APN 10 83,419,173 (GRCm39) missense possibly damaging 0.95
IGL02870:Washc4 APN 10 83,421,740 (GRCm39) missense probably benign
IGL03181:Washc4 APN 10 83,426,883 (GRCm39) missense probably damaging 1.00
IGL03247:Washc4 APN 10 83,400,327 (GRCm39) missense probably benign 0.02
R0458:Washc4 UTSW 10 83,382,663 (GRCm39) missense possibly damaging 0.70
R0462:Washc4 UTSW 10 83,392,777 (GRCm39) missense probably benign 0.00
R0471:Washc4 UTSW 10 83,394,598 (GRCm39) splice site probably benign
R1144:Washc4 UTSW 10 83,416,194 (GRCm39) missense probably damaging 0.97
R1560:Washc4 UTSW 10 83,391,973 (GRCm39) missense probably damaging 0.99
R1789:Washc4 UTSW 10 83,415,389 (GRCm39) missense possibly damaging 0.92
R1819:Washc4 UTSW 10 83,386,748 (GRCm39) missense probably benign 0.08
R2421:Washc4 UTSW 10 83,415,385 (GRCm39) missense probably damaging 0.97
R2882:Washc4 UTSW 10 83,415,365 (GRCm39) missense possibly damaging 0.93
R2902:Washc4 UTSW 10 83,390,627 (GRCm39) nonsense probably null
R3436:Washc4 UTSW 10 83,405,866 (GRCm39) missense probably benign 0.33
R3437:Washc4 UTSW 10 83,405,866 (GRCm39) missense probably benign 0.33
R3552:Washc4 UTSW 10 83,382,720 (GRCm39) missense probably benign 0.45
R4646:Washc4 UTSW 10 83,410,407 (GRCm39) missense possibly damaging 0.71
R4647:Washc4 UTSW 10 83,410,407 (GRCm39) missense possibly damaging 0.71
R4648:Washc4 UTSW 10 83,410,407 (GRCm39) missense possibly damaging 0.71
R4732:Washc4 UTSW 10 83,410,343 (GRCm39) missense probably benign
R4733:Washc4 UTSW 10 83,410,343 (GRCm39) missense probably benign
R4750:Washc4 UTSW 10 83,426,916 (GRCm39) missense probably damaging 0.99
R4835:Washc4 UTSW 10 83,415,376 (GRCm39) missense possibly damaging 0.93
R5024:Washc4 UTSW 10 83,419,200 (GRCm39) missense possibly damaging 0.71
R5055:Washc4 UTSW 10 83,392,771 (GRCm39) missense probably damaging 0.99
R5414:Washc4 UTSW 10 83,391,967 (GRCm39) missense possibly damaging 0.95
R5423:Washc4 UTSW 10 83,415,418 (GRCm39) missense possibly damaging 0.71
R5428:Washc4 UTSW 10 83,410,386 (GRCm39) missense probably benign 0.00
R5506:Washc4 UTSW 10 83,417,201 (GRCm39) missense probably damaging 0.97
R5540:Washc4 UTSW 10 83,409,657 (GRCm39) missense probably damaging 0.99
R5667:Washc4 UTSW 10 83,405,892 (GRCm39) missense probably damaging 0.97
R5671:Washc4 UTSW 10 83,405,892 (GRCm39) missense probably damaging 0.97
R5777:Washc4 UTSW 10 83,391,469 (GRCm39) missense probably damaging 1.00
R6369:Washc4 UTSW 10 83,410,308 (GRCm39) missense probably damaging 1.00
R6370:Washc4 UTSW 10 83,407,226 (GRCm39) missense possibly damaging 0.85
R6500:Washc4 UTSW 10 83,394,687 (GRCm39) missense probably damaging 1.00
R6645:Washc4 UTSW 10 83,408,059 (GRCm39) nonsense probably null
R6657:Washc4 UTSW 10 83,394,482 (GRCm39) missense possibly damaging 0.92
R6829:Washc4 UTSW 10 83,396,380 (GRCm39) missense probably damaging 0.97
R6862:Washc4 UTSW 10 83,394,757 (GRCm39) missense possibly damaging 0.92
R6899:Washc4 UTSW 10 83,411,919 (GRCm39) missense probably benign 0.07
R7144:Washc4 UTSW 10 83,409,638 (GRCm39) critical splice acceptor site probably null
R7163:Washc4 UTSW 10 83,426,897 (GRCm39) missense probably damaging 0.99
R7477:Washc4 UTSW 10 83,410,307 (GRCm39) missense probably damaging 0.99
R7900:Washc4 UTSW 10 83,409,637 (GRCm39) splice site probably null
R8194:Washc4 UTSW 10 83,416,163 (GRCm39) missense possibly damaging 0.51
R8491:Washc4 UTSW 10 83,411,987 (GRCm39) missense probably benign 0.24
R8791:Washc4 UTSW 10 83,386,748 (GRCm39) missense probably benign 0.08
R8804:Washc4 UTSW 10 83,408,015 (GRCm39) missense probably damaging 0.99
R8896:Washc4 UTSW 10 83,405,882 (GRCm39) missense probably damaging 0.98
R9084:Washc4 UTSW 10 83,422,499 (GRCm39) missense possibly damaging 0.92
R9452:Washc4 UTSW 10 83,396,387 (GRCm39) missense probably benign
R9532:Washc4 UTSW 10 83,417,258 (GRCm39) splice site probably benign
X0017:Washc4 UTSW 10 83,427,007 (GRCm39) missense probably damaging 1.00
X0066:Washc4 UTSW 10 83,394,693 (GRCm39) frame shift probably null
Z1088:Washc4 UTSW 10 83,412,605 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGTGCCTAAGATTTGGAGGGC -3'
(R):5'- ATCATTGCAGGTCAGTTGTAGG -3'

Sequencing Primer
(F):5'- GGGATGCCAAGGTCTTCTTAAAAC -3'
(R):5'- GGGTGGGTTATTAAATCAAATGACC -3'
Posted On 2021-08-31