Incidental Mutation 'R8961:Snx13'
ID 682354
Institutional Source Beutler Lab
Gene Symbol Snx13
Ensembl Gene ENSMUSG00000020590
Gene Name sorting nexin 13
Synonyms RGS-PX1
MMRRC Submission 068795-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8961 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 35097191-35197479 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 35155285 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 450 (Y450H)
Ref Sequence ENSEMBL: ENSMUSP00000038430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048519] [ENSMUST00000163677] [ENSMUST00000221272]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000048519
AA Change: Y450H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038430
Gene: ENSMUSG00000020590
AA Change: Y450H

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 34 51 N/A INTRINSIC
PXA 98 285 9.09e-102 SMART
coiled coil region 293 320 N/A INTRINSIC
RGS 374 514 4.63e-32 SMART
low complexity region 546 562 N/A INTRINSIC
PX 564 677 2.88e-31 SMART
Pfam:Nexin_C 793 903 1.9e-29 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000130182
Gene: ENSMUSG00000020590
AA Change: Y450H

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 34 51 N/A INTRINSIC
PXA 97 284 9.09e-102 SMART
coiled coil region 292 319 N/A INTRINSIC
RGS 373 513 4.63e-32 SMART
low complexity region 545 561 N/A INTRINSIC
PX 563 676 2.88e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221272
Meta Mutation Damage Score 0.6503 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PHOX domain- and RGS domain-containing protein that belongs to the sorting nexin (SNX) family and the regulator of G protein signaling (RGS) family. The PHOX domain is a phosphoinositide binding domain, and the SNX family members are involved in intracellular trafficking. The RGS family members are regulatory molecules that act as GTPase activating proteins for G alpha subunits of heterotrimeric G proteins. The RGS domain of this protein interacts with G alpha(s), accelerates its GTP hydrolysis, and attenuates G alpha(s)-mediated signaling. Overexpression of this protein delayes lysosomal degradation of the epidermal growth factor receptor. Because of its bifunctional role, this protein may link heterotrimeric G protein signaling and vesicular trafficking. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are growth retarded and die at midgestation with defects in neural tube closure, vasculogenesis and placental development. Mutant visceral yolk sac endoderm cells exhibit altered endocytic compartments, abundant autophagic vacuoles and mislocalization of endocytic markers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700064H15Rik T A 3: 19,664,633 (GRCm39) probably benign Het
Angptl6 T C 9: 20,789,467 (GRCm39) T142A probably benign Het
Atp6v1b2 A G 8: 69,555,414 (GRCm39) I202V probably benign Het
B3gat2 A T 1: 23,801,900 (GRCm39) D62V probably benign Het
Ccdc180 A G 4: 45,929,573 (GRCm39) D1211G possibly damaging Het
Ccp110 T G 7: 118,322,110 (GRCm39) D588E probably damaging Het
Cdh6 A T 15: 13,041,447 (GRCm39) I539K probably benign Het
Chd5 A G 4: 152,467,489 (GRCm39) probably benign Het
Crim1 T C 17: 78,680,117 (GRCm39) S953P possibly damaging Het
Dennd2a T C 6: 39,462,555 (GRCm39) K652E probably damaging Het
Dnajb3 T A 1: 88,132,998 (GRCm39) R135* probably null Het
Dnajc25 T A 4: 59,020,438 (GRCm39) M168K Het
Elfn2 T C 15: 78,557,378 (GRCm39) S390G probably benign Het
Ephb6 C T 6: 41,590,293 (GRCm39) A15V probably benign Het
Fam135b T A 15: 71,404,812 (GRCm39) N78I probably damaging Het
Flot2 G A 11: 77,945,632 (GRCm39) probably benign Het
Gm10277 T A 11: 77,677,826 (GRCm39) probably benign Het
Itpr1 T C 6: 108,470,666 (GRCm39) V2198A possibly damaging Het
Kndc1 T A 7: 139,503,976 (GRCm39) F1093L possibly damaging Het
Kndc1 C T 7: 139,507,708 (GRCm39) S1222F possibly damaging Het
Kpna4 T C 3: 68,986,821 (GRCm39) T523A probably benign Het
Krt39 T C 11: 99,409,931 (GRCm39) D202G possibly damaging Het
Loxhd1 C T 18: 77,472,765 (GRCm39) T985M probably damaging Het
Mdc1 T C 17: 36,159,407 (GRCm39) S596P probably benign Het
Misp A G 10: 79,663,823 (GRCm39) Q599R probably benign Het
Mogs C A 6: 83,092,720 (GRCm39) F53L probably benign Het
Mthfr A T 4: 148,128,099 (GRCm39) N167Y probably damaging Het
Nod1 C T 6: 54,926,461 (GRCm39) E53K probably damaging Het
Or1j11 A T 2: 36,312,177 (GRCm39) I256F probably damaging Het
Or52l1 A G 7: 104,830,376 (GRCm39) I48T possibly damaging Het
Or5m5 T A 2: 85,814,610 (GRCm39) M142K probably damaging Het
Or6c5c C T 10: 129,299,225 (GRCm39) P227S probably damaging Het
Or6z5 T C 7: 6,477,763 (GRCm39) V218A probably benign Het
Pkd1l2 A G 8: 117,726,717 (GRCm39) I2263T possibly damaging Het
Rbbp8 T C 18: 11,865,262 (GRCm39) M717T probably benign Het
Rest A G 5: 77,416,482 (GRCm39) H232R probably damaging Het
Rps6ka1 A G 4: 133,587,362 (GRCm39) probably null Het
Rtf1 T A 2: 119,557,377 (GRCm39) F465I probably benign Het
Skil T C 3: 31,167,729 (GRCm39) S454P probably benign Het
Spef2 T A 15: 9,647,414 (GRCm39) E971V possibly damaging Het
Sqle T A 15: 59,187,695 (GRCm39) M1K probably null Het
Srcap C G 7: 127,141,101 (GRCm39) P1566R probably damaging Het
Stxbp5l ATTTT ATTTTT 16: 37,036,414 (GRCm39) probably null Het
Tmc3 T C 7: 83,256,970 (GRCm39) Y408H probably damaging Het
Uba2 A T 7: 33,855,642 (GRCm39) probably benign Het
Unc13c G T 9: 73,839,524 (GRCm39) N442K probably benign Het
Vmn1r21 T A 6: 57,820,829 (GRCm39) H205L probably damaging Het
Vwa7 C T 17: 35,238,086 (GRCm39) T229I probably damaging Het
Washc4 A G 10: 83,409,657 (GRCm39) D602G probably damaging Het
Zcchc9 C A 13: 91,953,955 (GRCm39) probably benign Het
Other mutations in Snx13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Snx13 APN 12 35,148,279 (GRCm39) missense probably damaging 1.00
IGL01143:Snx13 APN 12 35,182,159 (GRCm39) missense probably damaging 0.96
IGL01446:Snx13 APN 12 35,174,479 (GRCm39) nonsense probably null
IGL01519:Snx13 APN 12 35,188,471 (GRCm39) unclassified probably benign
IGL01902:Snx13 APN 12 35,183,306 (GRCm39) critical splice acceptor site probably null
IGL01903:Snx13 APN 12 35,135,968 (GRCm39) missense probably benign 0.06
IGL02146:Snx13 APN 12 35,151,078 (GRCm39) missense probably benign 0.00
IGL02175:Snx13 APN 12 35,182,061 (GRCm39) missense possibly damaging 0.83
IGL02197:Snx13 APN 12 35,156,800 (GRCm39) missense probably damaging 1.00
IGL02200:Snx13 APN 12 35,136,884 (GRCm39) missense probably damaging 1.00
IGL02476:Snx13 APN 12 35,136,940 (GRCm39) missense probably damaging 1.00
IGL03171:Snx13 APN 12 35,150,539 (GRCm39) missense probably benign 0.28
resistance UTSW 12 35,162,444 (GRCm39) missense probably damaging 1.00
IGL02835:Snx13 UTSW 12 35,182,126 (GRCm39) missense possibly damaging 0.48
P0042:Snx13 UTSW 12 35,157,541 (GRCm39) missense probably damaging 1.00
R0047:Snx13 UTSW 12 35,151,123 (GRCm39) splice site probably benign
R0047:Snx13 UTSW 12 35,151,123 (GRCm39) splice site probably benign
R0344:Snx13 UTSW 12 35,136,899 (GRCm39) nonsense probably null
R1240:Snx13 UTSW 12 35,141,405 (GRCm39) missense probably damaging 0.99
R1335:Snx13 UTSW 12 35,182,123 (GRCm39) missense probably benign 0.16
R1451:Snx13 UTSW 12 35,128,983 (GRCm39) missense probably benign 0.00
R1617:Snx13 UTSW 12 35,136,895 (GRCm39) missense probably damaging 0.99
R2065:Snx13 UTSW 12 35,188,065 (GRCm39) missense possibly damaging 0.91
R2111:Snx13 UTSW 12 35,188,084 (GRCm39) missense probably damaging 1.00
R2385:Snx13 UTSW 12 35,169,792 (GRCm39) missense probably benign 0.36
R2437:Snx13 UTSW 12 35,132,926 (GRCm39) missense probably benign 0.14
R2511:Snx13 UTSW 12 35,188,080 (GRCm39) missense probably benign 0.13
R2860:Snx13 UTSW 12 35,188,116 (GRCm39) missense probably benign 0.45
R2861:Snx13 UTSW 12 35,188,116 (GRCm39) missense probably benign 0.45
R2862:Snx13 UTSW 12 35,188,116 (GRCm39) missense probably benign 0.45
R2992:Snx13 UTSW 12 35,155,190 (GRCm39) missense probably damaging 1.00
R3938:Snx13 UTSW 12 35,194,096 (GRCm39) missense probably benign 0.10
R4304:Snx13 UTSW 12 35,172,941 (GRCm39) missense probably benign 0.10
R4532:Snx13 UTSW 12 35,194,219 (GRCm39) missense probably damaging 0.98
R4692:Snx13 UTSW 12 35,136,917 (GRCm39) missense possibly damaging 0.82
R4783:Snx13 UTSW 12 35,148,285 (GRCm39) missense probably damaging 1.00
R4914:Snx13 UTSW 12 35,182,032 (GRCm39) missense possibly damaging 0.84
R5309:Snx13 UTSW 12 35,194,324 (GRCm39) nonsense probably null
R5425:Snx13 UTSW 12 35,150,643 (GRCm39) nonsense probably null
R5476:Snx13 UTSW 12 35,156,819 (GRCm39) splice site probably null
R5533:Snx13 UTSW 12 35,173,025 (GRCm39) critical splice donor site probably null
R5564:Snx13 UTSW 12 35,174,471 (GRCm39) missense possibly damaging 0.61
R5572:Snx13 UTSW 12 35,153,119 (GRCm39) missense probably damaging 1.00
R5635:Snx13 UTSW 12 35,190,170 (GRCm39) missense probably benign 0.00
R6018:Snx13 UTSW 12 35,097,318 (GRCm39) start gained probably benign
R6612:Snx13 UTSW 12 35,156,758 (GRCm39) missense probably benign 0.19
R6618:Snx13 UTSW 12 35,162,444 (GRCm39) missense probably damaging 1.00
R6737:Snx13 UTSW 12 35,190,185 (GRCm39) missense probably damaging 0.98
R6964:Snx13 UTSW 12 35,169,788 (GRCm39) missense possibly damaging 0.81
R7186:Snx13 UTSW 12 35,142,912 (GRCm39) missense probably damaging 0.99
R7372:Snx13 UTSW 12 35,128,950 (GRCm39) missense probably benign 0.00
R7429:Snx13 UTSW 12 35,183,357 (GRCm39) missense possibly damaging 0.89
R7430:Snx13 UTSW 12 35,183,357 (GRCm39) missense possibly damaging 0.89
R7537:Snx13 UTSW 12 35,135,981 (GRCm39) missense probably damaging 1.00
R7567:Snx13 UTSW 12 35,136,913 (GRCm39) missense probably damaging 1.00
R7582:Snx13 UTSW 12 35,174,534 (GRCm39) nonsense probably null
R7767:Snx13 UTSW 12 35,157,483 (GRCm39) missense probably damaging 1.00
R7771:Snx13 UTSW 12 35,174,527 (GRCm39) missense probably benign
R7838:Snx13 UTSW 12 35,155,174 (GRCm39) missense probably benign 0.26
R7901:Snx13 UTSW 12 35,150,624 (GRCm39) missense probably benign 0.02
R8029:Snx13 UTSW 12 35,169,885 (GRCm39) missense probably damaging 1.00
R8418:Snx13 UTSW 12 35,148,233 (GRCm39) missense probably damaging 1.00
R9197:Snx13 UTSW 12 35,155,196 (GRCm39) missense probably benign 0.00
R9372:Snx13 UTSW 12 35,151,048 (GRCm39) missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GTCTGCCATTAGTAACTGTCTTGC -3'
(R):5'- TTAGATTCTTCTCCAGAGCAATGAG -3'

Sequencing Primer
(F):5'- CCTCTATGTGGTAGATTATATGCAGC -3'
(R):5'- CCAGAGCAATGAGAATAAAAATACAC -3'
Posted On 2021-08-31