Incidental Mutation 'R8961:Stxbp5l'
ID 682361
Institutional Source Beutler Lab
Gene Symbol Stxbp5l
Ensembl Gene ENSMUSG00000022829
Gene Name syntaxin binding protein 5-like
Synonyms insulin level locus 1, T2dm1, LLGL4, tomosyn-2, t2md1, A830015P08Rik
MMRRC Submission 068795-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8961 (G1)
Quality Score 144.467
Status Validated
Chromosome 16
Chromosomal Location 36935304-37205324 bp(-) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) ATTTT to ATTTTT at 37036414 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114775] [ENSMUST00000114780] [ENSMUST00000114781] [ENSMUST00000114782] [ENSMUST00000114787]
AlphaFold Q5DQR4
Predicted Effect probably null
Transcript: ENSMUST00000114775
SMART Domains Protein: ENSMUSP00000110423
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 3.5e-45 PFAM
Blast:WD40 397 466 6e-43 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000114780
SMART Domains Protein: ENSMUSP00000110428
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 8.6e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 731 988 3e-9 PFAM
PDB:1URQ|A 1038 1097 2e-25 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114781
SMART Domains Protein: ENSMUSP00000110429
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 8.9e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 755 1012 3.1e-9 PFAM
PDB:1URQ|A 1062 1121 2e-25 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114782
SMART Domains Protein: ENSMUSP00000110430
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 9.2e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 785 1045 3.1e-9 PFAM
PDB:1URQ|A 1095 1154 2e-25 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114787
SMART Domains Protein: ENSMUSP00000110435
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 287 396 8.7e-35 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 811 1069 3.3e-9 PFAM
PDB:1URQ|A 1119 1178 2e-25 PDB
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to syntaxin-binding protein 5 and contains ten N-terminal WD40 repeats, four variable region WD40 repeats, and a C-terminal R-SNARE domain. Studies of the orthologous proteins in mouse and rat have shown that the encoded protein may inhibit exocytosis in neurosecretory cells, and may negatively regulate the secretion of insulin. A missense variant in this gene is likely the cause of an infantile-onset neurodegenerative disorder diagnosed in two siblings of consanguineous parents. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a QTL derived from BTBR exhibit increased fasting serum glucose and decreased fasting serum insulin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700064H15Rik T A 3: 19,664,633 (GRCm39) probably benign Het
Angptl6 T C 9: 20,789,467 (GRCm39) T142A probably benign Het
Atp6v1b2 A G 8: 69,555,414 (GRCm39) I202V probably benign Het
B3gat2 A T 1: 23,801,900 (GRCm39) D62V probably benign Het
Ccdc180 A G 4: 45,929,573 (GRCm39) D1211G possibly damaging Het
Ccp110 T G 7: 118,322,110 (GRCm39) D588E probably damaging Het
Cdh6 A T 15: 13,041,447 (GRCm39) I539K probably benign Het
Chd5 A G 4: 152,467,489 (GRCm39) probably benign Het
Crim1 T C 17: 78,680,117 (GRCm39) S953P possibly damaging Het
Dennd2a T C 6: 39,462,555 (GRCm39) K652E probably damaging Het
Dnajb3 T A 1: 88,132,998 (GRCm39) R135* probably null Het
Dnajc25 T A 4: 59,020,438 (GRCm39) M168K Het
Elfn2 T C 15: 78,557,378 (GRCm39) S390G probably benign Het
Ephb6 C T 6: 41,590,293 (GRCm39) A15V probably benign Het
Fam135b T A 15: 71,404,812 (GRCm39) N78I probably damaging Het
Flot2 G A 11: 77,945,632 (GRCm39) probably benign Het
Gm10277 T A 11: 77,677,826 (GRCm39) probably benign Het
Itpr1 T C 6: 108,470,666 (GRCm39) V2198A possibly damaging Het
Kndc1 T A 7: 139,503,976 (GRCm39) F1093L possibly damaging Het
Kndc1 C T 7: 139,507,708 (GRCm39) S1222F possibly damaging Het
Kpna4 T C 3: 68,986,821 (GRCm39) T523A probably benign Het
Krt39 T C 11: 99,409,931 (GRCm39) D202G possibly damaging Het
Loxhd1 C T 18: 77,472,765 (GRCm39) T985M probably damaging Het
Mdc1 T C 17: 36,159,407 (GRCm39) S596P probably benign Het
Misp A G 10: 79,663,823 (GRCm39) Q599R probably benign Het
Mogs C A 6: 83,092,720 (GRCm39) F53L probably benign Het
Mthfr A T 4: 148,128,099 (GRCm39) N167Y probably damaging Het
Nod1 C T 6: 54,926,461 (GRCm39) E53K probably damaging Het
Or1j11 A T 2: 36,312,177 (GRCm39) I256F probably damaging Het
Or52l1 A G 7: 104,830,376 (GRCm39) I48T possibly damaging Het
Or5m5 T A 2: 85,814,610 (GRCm39) M142K probably damaging Het
Or6c5c C T 10: 129,299,225 (GRCm39) P227S probably damaging Het
Or6z5 T C 7: 6,477,763 (GRCm39) V218A probably benign Het
Pkd1l2 A G 8: 117,726,717 (GRCm39) I2263T possibly damaging Het
Rbbp8 T C 18: 11,865,262 (GRCm39) M717T probably benign Het
Rest A G 5: 77,416,482 (GRCm39) H232R probably damaging Het
Rps6ka1 A G 4: 133,587,362 (GRCm39) probably null Het
Rtf1 T A 2: 119,557,377 (GRCm39) F465I probably benign Het
Skil T C 3: 31,167,729 (GRCm39) S454P probably benign Het
Snx13 T C 12: 35,155,285 (GRCm39) Y450H probably damaging Het
Spef2 T A 15: 9,647,414 (GRCm39) E971V possibly damaging Het
Sqle T A 15: 59,187,695 (GRCm39) M1K probably null Het
Srcap C G 7: 127,141,101 (GRCm39) P1566R probably damaging Het
Tmc3 T C 7: 83,256,970 (GRCm39) Y408H probably damaging Het
Uba2 A T 7: 33,855,642 (GRCm39) probably benign Het
Unc13c G T 9: 73,839,524 (GRCm39) N442K probably benign Het
Vmn1r21 T A 6: 57,820,829 (GRCm39) H205L probably damaging Het
Vwa7 C T 17: 35,238,086 (GRCm39) T229I probably damaging Het
Washc4 A G 10: 83,409,657 (GRCm39) D602G probably damaging Het
Zcchc9 C A 13: 91,953,955 (GRCm39) probably benign Het
Other mutations in Stxbp5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Stxbp5l APN 16 37,028,462 (GRCm39) missense possibly damaging 0.82
IGL01082:Stxbp5l APN 16 37,024,940 (GRCm39) missense possibly damaging 0.89
IGL01448:Stxbp5l APN 16 37,036,341 (GRCm39) missense probably damaging 0.99
IGL01475:Stxbp5l APN 16 37,165,454 (GRCm39) missense possibly damaging 0.95
IGL01899:Stxbp5l APN 16 37,020,954 (GRCm39) missense probably benign 0.19
IGL02232:Stxbp5l APN 16 37,150,257 (GRCm39) missense probably damaging 1.00
IGL02389:Stxbp5l APN 16 37,028,567 (GRCm39) missense probably benign 0.00
IGL02745:Stxbp5l APN 16 37,007,016 (GRCm39) nonsense probably null
IGL03125:Stxbp5l APN 16 37,007,083 (GRCm39) missense probably benign 0.02
R0058:Stxbp5l UTSW 16 36,962,736 (GRCm39) missense possibly damaging 0.76
R0345:Stxbp5l UTSW 16 37,108,670 (GRCm39) missense probably damaging 1.00
R0359:Stxbp5l UTSW 16 37,036,440 (GRCm39) splice site probably benign
R0454:Stxbp5l UTSW 16 36,954,646 (GRCm39) missense possibly damaging 0.94
R0525:Stxbp5l UTSW 16 36,950,159 (GRCm39) critical splice donor site probably null
R0543:Stxbp5l UTSW 16 37,028,458 (GRCm39) missense probably damaging 1.00
R0606:Stxbp5l UTSW 16 37,024,883 (GRCm39) missense possibly damaging 0.46
R0607:Stxbp5l UTSW 16 36,962,794 (GRCm39) missense probably benign 0.00
R1333:Stxbp5l UTSW 16 37,068,231 (GRCm39) critical splice donor site probably null
R1593:Stxbp5l UTSW 16 36,936,414 (GRCm39) missense probably damaging 0.96
R1605:Stxbp5l UTSW 16 37,028,473 (GRCm39) missense probably benign 0.34
R1670:Stxbp5l UTSW 16 37,111,289 (GRCm39) critical splice donor site probably null
R2077:Stxbp5l UTSW 16 37,056,637 (GRCm39) missense possibly damaging 0.93
R2209:Stxbp5l UTSW 16 37,036,398 (GRCm39) missense probably damaging 0.98
R2504:Stxbp5l UTSW 16 36,936,029 (GRCm39) missense probably damaging 1.00
R2909:Stxbp5l UTSW 16 37,028,548 (GRCm39) missense possibly damaging 0.89
R2917:Stxbp5l UTSW 16 37,021,004 (GRCm39) nonsense probably null
R2918:Stxbp5l UTSW 16 37,021,004 (GRCm39) nonsense probably null
R2935:Stxbp5l UTSW 16 36,954,551 (GRCm39) missense possibly damaging 0.76
R3693:Stxbp5l UTSW 16 37,061,708 (GRCm39) nonsense probably null
R3694:Stxbp5l UTSW 16 37,061,708 (GRCm39) nonsense probably null
R3695:Stxbp5l UTSW 16 37,061,708 (GRCm39) nonsense probably null
R4133:Stxbp5l UTSW 16 37,028,481 (GRCm39) missense possibly damaging 0.80
R4180:Stxbp5l UTSW 16 37,068,242 (GRCm39) missense probably benign 0.05
R4676:Stxbp5l UTSW 16 37,076,246 (GRCm39) missense probably damaging 1.00
R4757:Stxbp5l UTSW 16 37,008,996 (GRCm39) missense probably damaging 1.00
R4758:Stxbp5l UTSW 16 36,954,592 (GRCm39) missense probably benign 0.18
R5105:Stxbp5l UTSW 16 36,962,734 (GRCm39) missense probably benign 0.43
R5278:Stxbp5l UTSW 16 37,007,016 (GRCm39) missense probably benign 0.19
R5358:Stxbp5l UTSW 16 36,994,688 (GRCm39) missense probably damaging 0.99
R5411:Stxbp5l UTSW 16 36,950,213 (GRCm39) missense probably damaging 1.00
R5773:Stxbp5l UTSW 16 37,028,459 (GRCm39) missense probably damaging 1.00
R6539:Stxbp5l UTSW 16 36,950,177 (GRCm39) missense probably damaging 1.00
R6869:Stxbp5l UTSW 16 37,024,810 (GRCm39) missense possibly damaging 0.74
R6892:Stxbp5l UTSW 16 37,008,991 (GRCm39) missense possibly damaging 0.94
R7369:Stxbp5l UTSW 16 36,954,703 (GRCm39) missense probably benign 0.12
R7555:Stxbp5l UTSW 16 37,143,965 (GRCm39) missense probably damaging 1.00
R7657:Stxbp5l UTSW 16 37,030,534 (GRCm39) missense probably null 0.21
R8171:Stxbp5l UTSW 16 37,028,416 (GRCm39) missense noncoding transcript
R8338:Stxbp5l UTSW 16 36,994,718 (GRCm39) missense probably damaging 1.00
R8732:Stxbp5l UTSW 16 37,061,809 (GRCm39) missense probably benign
R8833:Stxbp5l UTSW 16 37,024,814 (GRCm39) missense probably benign 0.44
R8883:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8898:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8899:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8906:Stxbp5l UTSW 16 37,028,526 (GRCm39) missense probably damaging 1.00
R8918:Stxbp5l UTSW 16 36,954,892 (GRCm39) missense
R8959:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8989:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R9027:Stxbp5l UTSW 16 37,165,473 (GRCm39) missense probably damaging 1.00
R9044:Stxbp5l UTSW 16 37,024,930 (GRCm39) missense possibly damaging 0.77
R9226:Stxbp5l UTSW 16 37,076,206 (GRCm39) missense probably damaging 0.96
R9284:Stxbp5l UTSW 16 37,028,442 (GRCm39) nonsense probably null
R9351:Stxbp5l UTSW 16 36,936,047 (GRCm39) missense probably damaging 1.00
R9425:Stxbp5l UTSW 16 36,994,706 (GRCm39) missense possibly damaging 0.83
R9545:Stxbp5l UTSW 16 37,028,625 (GRCm39) critical splice acceptor site probably null
R9567:Stxbp5l UTSW 16 37,061,734 (GRCm39) missense probably benign 0.37
R9616:Stxbp5l UTSW 16 37,036,314 (GRCm39) missense probably damaging 1.00
R9781:Stxbp5l UTSW 16 37,165,485 (GRCm39) missense probably benign 0.38
Z1088:Stxbp5l UTSW 16 37,024,851 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAGTCACCTTGTATGGAAAGTC -3'
(R):5'- GATGTTGGCAGCCTGAAAAG -3'

Sequencing Primer
(F):5'- GCTTGACTCCTATAGAATAGAG -3'
(R):5'- TTGGCAGCCTGAAAAGAAAATTAAC -3'
Posted On 2021-08-31