Mutagenetix > Incidental Mutation

Incidental Mutation 'R8961:Crim1'

682364

Institutional Source

Beutler Lab

Gene Symbol

Crim1

Ensembl Gene

ENSMUSG00000024074

Gene Name

cysteine rich transmembrane BMP regulator 1 (chordin like)

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8961 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

78200248-78376592 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 78372688 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 953 (S953P)

Ref Sequence

ENSEMBL: ENSMUSP00000108117 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112498]

AlphaFold

Q9JLL0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112498
AA Change: S953P

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000108117
Gene: ENSMUSG00000024074
AA Change: S953P

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
IB	35	111	1.87e-5	SMART
VWC	336	390	6.04e-13	SMART
VWC	403	456	1.15e-9	SMART
Pfam:Antistasin	469	498	4.5e-10	PFAM
Pfam:Antistasin	505	532	1.5e-8	PFAM
Pfam:Antistasin	539	564	5.7e-9	PFAM
Pfam:Antistasin	567	592	1.7e-10	PFAM
VWC	608	662	1.26e-10	SMART
VWC	679	734	1.37e-11	SMART
VWC	753	808	1.46e-11	SMART
VWC	819	873	1.01e-14	SMART
transmembrane domain	940	962	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing six cysteine-rich repeat domains and an insulin-like growth factor-binding domain. The encoded protein may play a role in tissue development though interactions with members of the transforming growth factor beta family, such as bone morphogenetic proteins. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mutations in this locus cause perinatal lethality, syndactyly, and eye and kidney abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700064H15Rik	T	A	3: 19,610,469		probably benign	Het
Angptl6	T	C	9: 20,878,171	T142A	probably benign	Het
Atp6v1b2	A	G	8: 69,102,762	I202V	probably benign	Het
B3gat2	A	T	1: 23,762,819	D62V	probably benign	Het
Ccdc180	A	G	4: 45,929,573	D1211G	possibly damaging	Het
Ccp110	T	G	7: 118,722,887	D588E	probably damaging	Het
Cdh6	A	T	15: 13,041,361	I539K	probably benign	Het
Chd5	A	G	4: 152,383,032		probably benign	Het
Dennd2a	T	C	6: 39,485,621	K652E	probably damaging	Het
Dnajb3	T	A	1: 88,205,276	R135*	probably null	Het
Dnajc25	T	A	4: 59,020,438	M168K		Het
Elfn2	T	C	15: 78,673,178	S390G	probably benign	Het
Ephb6	C	T	6: 41,613,359	A15V	probably benign	Het
Fam135b	T	A	15: 71,532,963	N78I	probably damaging	Het
Flot2	G	A	11: 78,054,806		probably benign	Het
Gm10277	T	A	11: 77,787,000		probably benign	Het
Itpr1	T	C	6: 108,493,705	V2198A	possibly damaging	Het
Kndc1	T	A	7: 139,924,061	F1093L	possibly damaging	Het
Kndc1	C	T	7: 139,927,795	S1222F	possibly damaging	Het
Kpna4	T	C	3: 69,079,488	T523A	probably benign	Het
Krt39	T	C	11: 99,519,105	D202G	possibly damaging	Het
Loxhd1	C	T	18: 77,385,069	T985M	probably damaging	Het
Mdc1	T	C	17: 35,848,515	S596P	probably benign	Het
Misp	A	G	10: 79,827,989	Q599R	probably benign	Het
Mogs	C	A	6: 83,115,739	F53L	probably benign	Het
Mthfr	A	T	4: 148,043,642	N167Y	probably damaging	Het
Nod1	C	T	6: 54,949,476	E53K	probably damaging	Het
Olfr1030	T	A	2: 85,984,266	M142K	probably damaging	Het
Olfr1346	T	C	7: 6,474,764	V218A	probably benign	Het
Olfr339	A	T	2: 36,422,165	I256F	probably damaging	Het
Olfr685	A	G	7: 105,181,169	I48T	possibly damaging	Het
Olfr787	C	T	10: 129,463,356	P227S	probably damaging	Het
Pkd1l2	A	G	8: 116,999,978	I2263T	possibly damaging	Het
Rbbp8	T	C	18: 11,732,205	M717T	probably benign	Het
Rest	A	G	5: 77,268,635	H232R	probably damaging	Het
Rps6ka1	A	G	4: 133,860,051		probably null	Het
Rtf1	T	A	2: 119,726,896	F465I	probably benign	Het
Skil	T	C	3: 31,113,580	S454P	probably benign	Het
Snx13	T	C	12: 35,105,286	Y450H	probably damaging	Het
Spef2	T	A	15: 9,647,328	E971V	possibly damaging	Het
Sqle	T	A	15: 59,315,846	M1K	probably null	Het
Srcap	C	G	7: 127,541,929	P1566R	probably damaging	Het
Stxbp5l	ATTTT	ATTTTT	16: 37,216,052		probably null	Het
Tmc3	T	C	7: 83,607,762	Y408H	probably damaging	Het
Uba2	A	T	7: 34,156,217		probably benign	Het
Unc13c	G	T	9: 73,932,242	N442K	probably benign	Het
Vmn1r21	T	A	6: 57,843,844	H205L	probably damaging	Het
Vwa7	C	T	17: 35,019,110	T229I	probably damaging	Het
Washc4	A	G	10: 83,573,793	D602G	probably damaging	Het
Zcchc9	C	A	13: 91,805,836		probably benign	Het

Other mutations in Crim1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00815:Crim1	APN	17	78370091	missense	probably damaging	1.00
IGL01090:Crim1	APN	17	78347229	missense	probably damaging	0.97
IGL01490:Crim1	APN	17	78335296	missense	possibly damaging	0.94
IGL01686:Crim1	APN	17	78344434	missense	probably benign	0.09
IGL01769:Crim1	APN	17	78313235	missense	probably benign	0.02
IGL02004:Crim1	APN	17	78372575	splice site	probably benign
IGL02211:Crim1	APN	17	78355145	missense	probably damaging	1.00
IGL02275:Crim1	APN	17	78369998	missense	possibly damaging	0.56
IGL02408:Crim1	APN	17	78315654	missense	possibly damaging	0.78
IGL02411:Crim1	APN	17	78335334	nonsense	probably null
IGL02453:Crim1	APN	17	78344484	missense	probably damaging	1.00
IGL02481:Crim1	APN	17	78350798	missense	probably damaging	0.98
IGL02632:Crim1	APN	17	78372674	missense	probably benign	0.08
IGL02652:Crim1	APN	17	78315677	missense	probably damaging	1.00
IGL02696:Crim1	APN	17	78279973	missense	probably damaging	0.96
IGL02811:Crim1	APN	17	78350701	missense	possibly damaging	0.62
IGL03105:Crim1	APN	17	78315750	splice site	probably benign
IGL03349:Crim1	APN	17	78355150	nonsense	probably null
bugeye	UTSW	17	78281347	missense	possibly damaging	0.94
IGL03097:Crim1	UTSW	17	78367798	missense	probably benign	0.00
R0227:Crim1	UTSW	17	78344509	splice site	probably benign
R0458:Crim1	UTSW	17	78313226	missense	probably damaging	0.98
R0482:Crim1	UTSW	17	78372579	missense	probably benign	0.00
R0989:Crim1	UTSW	17	78200944	missense	probably benign	0.21
R1266:Crim1	UTSW	17	78200833	small deletion	probably benign
R1529:Crim1	UTSW	17	78367954	missense	probably benign
R1679:Crim1	UTSW	17	78200799	missense	probably benign	0.27
R1909:Crim1	UTSW	17	78313127	missense	probably benign	0.26
R2273:Crim1	UTSW	17	78355179	critical splice donor site	probably null
R3899:Crim1	UTSW	17	78281354	missense	probably benign	0.00
R3909:Crim1	UTSW	17	78281239	splice site	probably benign
R4092:Crim1	UTSW	17	78350836	missense	probably damaging	1.00
R4154:Crim1	UTSW	17	78237843	missense	probably benign	0.01
R4687:Crim1	UTSW	17	78303025	missense	probably damaging	1.00
R5022:Crim1	UTSW	17	78280129	missense	possibly damaging	0.95
R5073:Crim1	UTSW	17	78281347	missense	possibly damaging	0.94
R5089:Crim1	UTSW	17	78374090	missense	probably damaging	1.00
R5284:Crim1	UTSW	17	78313266	missense	possibly damaging	0.83
R5461:Crim1	UTSW	17	78237807	missense	probably damaging	1.00
R5635:Crim1	UTSW	17	78315641	missense	probably damaging	1.00
R5686:Crim1	UTSW	17	78374083	missense	possibly damaging	0.63
R5956:Crim1	UTSW	17	78315717	missense	probably damaging	1.00
R6117:Crim1	UTSW	17	78303088	missense	probably damaging	1.00
R6129:Crim1	UTSW	17	78281309	missense	probably benign	0.17
R6265:Crim1	UTSW	17	78370085	missense	probably benign	0.01
R6812:Crim1	UTSW	17	78315600	missense	probably damaging	1.00
R6858:Crim1	UTSW	17	78315627	missense	probably damaging	1.00
R7920:Crim1	UTSW	17	78303064	missense	probably damaging	1.00
R8022:Crim1	UTSW	17	78315555	missense	possibly damaging	0.82
R8434:Crim1	UTSW	17	78347257	missense	probably benign	0.00
R8782:Crim1	UTSW	17	78200877	missense	probably damaging	1.00
R8971:Crim1	UTSW	17	78345980	missense	possibly damaging	0.89
R9245:Crim1	UTSW	17	78344442	missense	probably damaging	1.00
R9250:Crim1	UTSW	17	78370042	missense	probably benign
R9401:Crim1	UTSW	17	78350865	frame shift	probably null
R9402:Crim1	UTSW	17	78350865	frame shift	probably null
R9644:Crim1	UTSW	17	78280068	missense	probably damaging	1.00
R9702:Crim1	UTSW	17	78374087	missense	probably damaging	1.00
R9710:Crim1	UTSW	17	78303075	nonsense	probably null
X0064:Crim1	UTSW	17	78200833	small deletion	probably benign
Z1088:Crim1	UTSW	17	78367835	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- GCTGATCTCCATTTGCCGTG -3'
(R):5'- ATAAGCTTGCTTGCTACAGCTTG -3'

Sequencing Primer
(F):5'- TGCCGTGTAATTAAAATAATCCTCTG -3'
(R):5'- CTTGCTTGCTACAGCTTGATAAATAC -3'

Posted On

2021-08-31