Incidental Mutation 'R8962:Itga8'
ID 682368
Institutional Source Beutler Lab
Gene Symbol Itga8
Ensembl Gene ENSMUSG00000026768
Gene Name integrin alpha 8
Synonyms
MMRRC Submission 068796-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.870) question?
Stock # R8962 (G1)
Quality Score 190.009
Status Validated
Chromosome 2
Chromosomal Location 12111443-12306733 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 12196045 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 635 (H635R)
Ref Sequence ENSEMBL: ENSMUSP00000028106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]
AlphaFold A2ARA8
Predicted Effect possibly damaging
Transcript: ENSMUST00000028106
AA Change: H635R

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: H635R

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
SCOP:d1m1xa2 643 780 2e-46 SMART
SCOP:d1m1xa3 784 1000 2e-80 SMART
transmembrane domain 1011 1033 N/A INTRINSIC
Pfam:Integrin_alpha 1034 1048 2.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172791
SMART Domains Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
Meta Mutation Damage Score 0.0808 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik T A 9: 46,220,173 (GRCm39) M120L probably benign Het
Abat A G 16: 8,396,166 (GRCm39) T48A probably damaging Het
Abca8a A T 11: 109,969,634 (GRCm39) I314N probably damaging Het
Abr A T 11: 76,352,155 (GRCm39) V108D probably damaging Het
Adamts17 T G 7: 66,725,057 (GRCm39) L162V probably damaging Het
Adamts6 A T 13: 104,433,899 (GRCm39) K109N probably damaging Het
Ago3 A G 4: 126,241,595 (GRCm39) F68S probably damaging Het
Aifm3 T C 16: 17,324,200 (GRCm39) probably null Het
Ankrd26 T C 6: 118,512,104 (GRCm39) E506G probably benign Het
Apaf1 A G 10: 90,903,066 (GRCm39) L185P probably damaging Het
Atp8b3 G T 10: 80,355,896 (GRCm39) T1272K probably benign Het
Cars2 A G 8: 11,587,304 (GRCm39) V193A probably benign Het
Ccn5 C T 2: 163,667,160 (GRCm39) R54* probably null Het
Ccr8 A T 9: 119,923,613 (GRCm39) I243F possibly damaging Het
Col12a1 A G 9: 79,538,901 (GRCm39) V2465A probably damaging Het
Ctbp1 T C 5: 33,416,616 (GRCm39) N127S probably benign Het
Ddx10 A G 9: 53,149,377 (GRCm39) S117P probably damaging Het
Dgkb T C 12: 38,189,494 (GRCm39) probably null Het
Dnah11 T A 12: 117,916,273 (GRCm39) D3520V probably damaging Het
Dnah11 C T 12: 117,918,630 (GRCm39) D1530N probably damaging Het
Dock5 T C 14: 67,994,640 (GRCm39) T1807A probably benign Het
Drd3 C T 16: 43,641,842 (GRCm39) T386I probably damaging Het
Dsg1b A G 18: 20,542,316 (GRCm39) N941S probably damaging Het
Enpp3 T C 10: 24,696,513 (GRCm39) T141A probably benign Het
Esyt1 A T 10: 128,356,566 (GRCm39) C360S possibly damaging Het
Ethe1 T A 7: 24,305,682 (GRCm39) V143D probably damaging Het
Fam170b A G 14: 32,557,336 (GRCm39) D57G probably benign Het
Fam53c T C 18: 34,901,229 (GRCm39) S49P probably damaging Het
Fbp1 G A 13: 63,023,067 (GRCm39) L77F probably benign Het
Gm17093 A G 14: 44,758,149 (GRCm39) E110G Het
Gm21976 G T 13: 98,423,821 (GRCm39) silent Het
Golgb1 T C 16: 36,733,978 (GRCm39) I1075T probably damaging Het
Grip2 T C 6: 91,754,391 (GRCm39) D628G probably damaging Het
Gtpbp1 G T 15: 79,601,929 (GRCm39) L557F probably benign Het
Ighv12-3 A T 12: 114,330,204 (GRCm39) F97Y probably benign Het
Itgb7 A G 15: 102,127,037 (GRCm39) L466S probably damaging Het
Klc2 T C 19: 5,161,864 (GRCm39) D277G probably benign Het
Ktn1 A G 14: 47,901,248 (GRCm39) E2G probably damaging Het
Lcmt1 T A 7: 123,000,669 (GRCm39) Y68N probably damaging Het
Marchf10 G T 11: 105,280,815 (GRCm39) S490* probably null Het
Mterf1b A T 5: 4,246,437 (GRCm39) Y26F probably benign Het
Myo18b T A 5: 113,006,346 (GRCm39) I855F probably benign Het
Nek4 G A 14: 30,675,915 (GRCm39) M83I probably damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nos1 T C 5: 118,017,405 (GRCm39) V256A probably benign Het
Nr1h2 T C 7: 44,201,463 (GRCm39) T50A probably benign Het
Or14c42-ps1 T A 7: 86,211,317 (GRCm39) *126K probably null Het
Or4n4 A C 14: 50,518,816 (GRCm39) M298R possibly damaging Het
Ovol2 G C 2: 144,147,834 (GRCm39) R172G probably damaging Het
Parp14 A G 16: 35,677,187 (GRCm39) I927T probably damaging Het
Pcdhga7 T A 18: 37,848,879 (GRCm39) H295Q probably benign Het
Pkhd1l1 C T 15: 44,400,291 (GRCm39) T2145I probably damaging Het
Plekhs1 C T 19: 56,461,680 (GRCm39) T139I possibly damaging Het
Rab11fip3 T A 17: 26,231,007 (GRCm39) D746V probably damaging Het
Rnf214 A C 9: 45,809,728 (GRCm39) probably null Het
Rtn4ip1 A T 10: 43,822,415 (GRCm39) probably null Het
S1pr1 T C 3: 115,505,569 (GRCm39) R342G Het
Serpina1f T C 12: 103,656,131 (GRCm39) S366G probably benign Het
Sestd1 A T 2: 77,042,708 (GRCm39) M282K probably benign Het
Siglecf T G 7: 43,001,140 (GRCm39) V36G probably damaging Het
Slc1a1 T C 19: 28,886,869 (GRCm39) V410A probably damaging Het
Slc38a4 C A 15: 96,917,684 (GRCm39) D14Y probably benign Het
Slk C T 19: 47,610,748 (GRCm39) T806M probably damaging Het
Slurp2 C A 15: 74,615,249 (GRCm39) V48F possibly damaging Het
Socs1 A G 16: 10,602,642 (GRCm39) S32P possibly damaging Het
Son T C 16: 91,455,057 (GRCm39) V1268A possibly damaging Het
Sp7 C A 15: 102,274,880 (GRCm39) probably benign Het
Speer4a2 T G 5: 26,290,745 (GRCm39) E142A probably benign Het
Taar7b T G 10: 23,876,359 (GRCm39) S175A probably benign Het
Tet2 T C 3: 133,193,804 (GRCm39) N210S probably benign Het
Tkfc T C 19: 10,570,700 (GRCm39) D492G probably damaging Het
Tmc7 G A 7: 118,160,228 (GRCm39) P203L probably benign Het
Trmt9b A G 8: 36,972,729 (GRCm39) K60E probably damaging Het
Tshz2 C A 2: 169,726,524 (GRCm39) F373L probably damaging Het
Ttc29 T A 8: 79,042,336 (GRCm39) L307Q probably damaging Het
Tubd1 G A 11: 86,439,659 (GRCm39) M1I probably null Het
Vmn1r62 T A 7: 5,678,601 (GRCm39) M94K probably damaging Het
Vmn2r125 T C 4: 156,703,186 (GRCm39) I188T possibly damaging Het
Vmn2r5 T C 3: 64,398,564 (GRCm39) D805G probably damaging Het
Vmn2r6 A T 3: 64,463,576 (GRCm39) D419E probably damaging Het
Vps39 A T 2: 120,174,687 (GRCm39) Y98* probably null Het
Zdbf2 G A 1: 63,347,162 (GRCm39) G1847D probably benign Het
Zdhhc6 T C 19: 55,287,239 (GRCm39) E407G probably benign Het
Zfp407 A G 18: 84,577,057 (GRCm39) I1352T probably damaging Het
Zfp607a A G 7: 27,578,786 (GRCm39) K619E possibly damaging Het
Zfp811 A T 17: 33,017,622 (GRCm39) N139K probably benign Het
Other mutations in Itga8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Itga8 APN 2 12,260,777 (GRCm39) nonsense probably null
IGL00820:Itga8 APN 2 12,237,703 (GRCm39) missense possibly damaging 0.85
IGL01409:Itga8 APN 2 12,196,525 (GRCm39) missense probably benign
IGL01508:Itga8 APN 2 12,237,613 (GRCm39) missense possibly damaging 0.67
IGL01585:Itga8 APN 2 12,165,123 (GRCm39) splice site probably benign
IGL01590:Itga8 APN 2 12,165,144 (GRCm39) missense probably damaging 1.00
IGL01743:Itga8 APN 2 12,270,144 (GRCm39) missense probably benign 0.04
IGL02634:Itga8 APN 2 12,145,289 (GRCm39) missense possibly damaging 0.55
IGL02805:Itga8 APN 2 12,194,291 (GRCm39) missense possibly damaging 0.83
IGL03200:Itga8 APN 2 12,196,010 (GRCm39) missense probably benign 0.00
IGL03218:Itga8 APN 2 12,115,836 (GRCm39) missense possibly damaging 0.77
IGL03248:Itga8 APN 2 12,137,327 (GRCm39) missense probably benign 0.20
PIT4576001:Itga8 UTSW 2 12,234,903 (GRCm39) missense probably benign 0.19
R0196:Itga8 UTSW 2 12,209,540 (GRCm39) critical splice donor site probably null
R0356:Itga8 UTSW 2 12,187,532 (GRCm39) missense possibly damaging 0.73
R0466:Itga8 UTSW 2 12,237,697 (GRCm39) missense probably damaging 1.00
R0530:Itga8 UTSW 2 12,196,627 (GRCm39) missense probably damaging 0.99
R0715:Itga8 UTSW 2 12,196,053 (GRCm39) splice site probably benign
R0800:Itga8 UTSW 2 12,198,362 (GRCm39) missense possibly damaging 0.95
R0881:Itga8 UTSW 2 12,267,003 (GRCm39) splice site probably null
R1675:Itga8 UTSW 2 12,204,974 (GRCm39) missense probably damaging 0.99
R1758:Itga8 UTSW 2 12,270,144 (GRCm39) missense possibly damaging 0.83
R1939:Itga8 UTSW 2 12,305,657 (GRCm39) missense probably damaging 1.00
R2187:Itga8 UTSW 2 12,199,231 (GRCm39) missense possibly damaging 0.60
R2295:Itga8 UTSW 2 12,187,520 (GRCm39) missense probably benign 0.38
R2356:Itga8 UTSW 2 12,204,952 (GRCm39) missense probably benign
R2371:Itga8 UTSW 2 12,258,277 (GRCm39) missense probably damaging 1.00
R2412:Itga8 UTSW 2 12,306,526 (GRCm39) missense probably benign
R2440:Itga8 UTSW 2 12,183,491 (GRCm39) missense possibly damaging 0.70
R2848:Itga8 UTSW 2 12,165,215 (GRCm39) missense probably damaging 0.98
R3730:Itga8 UTSW 2 12,198,321 (GRCm39) missense possibly damaging 0.92
R3933:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R3982:Itga8 UTSW 2 12,305,774 (GRCm39) missense possibly damaging 0.92
R4513:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4514:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4660:Itga8 UTSW 2 12,270,069 (GRCm39) missense probably damaging 1.00
R4890:Itga8 UTSW 2 12,198,102 (GRCm39) splice site probably benign
R5533:Itga8 UTSW 2 12,165,161 (GRCm39) missense possibly damaging 0.90
R5619:Itga8 UTSW 2 12,270,139 (GRCm39) missense probably damaging 1.00
R5720:Itga8 UTSW 2 12,115,898 (GRCm39) missense probably damaging 0.99
R5749:Itga8 UTSW 2 12,266,889 (GRCm39) missense probably damaging 1.00
R5930:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R5954:Itga8 UTSW 2 12,137,297 (GRCm39) missense probably damaging 0.99
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6211:Itga8 UTSW 2 12,198,320 (GRCm39) missense probably damaging 1.00
R6337:Itga8 UTSW 2 12,258,280 (GRCm39) nonsense probably null
R6442:Itga8 UTSW 2 12,234,954 (GRCm39) missense probably benign 0.00
R6491:Itga8 UTSW 2 12,209,587 (GRCm39) missense probably damaging 1.00
R6543:Itga8 UTSW 2 12,306,455 (GRCm39) missense probably damaging 0.99
R6574:Itga8 UTSW 2 12,234,972 (GRCm39) missense probably benign 0.17
R6760:Itga8 UTSW 2 12,306,451 (GRCm39) missense probably damaging 1.00
R6858:Itga8 UTSW 2 12,204,892 (GRCm39) missense probably benign 0.00
R6943:Itga8 UTSW 2 12,160,182 (GRCm39) critical splice donor site probably null
R7048:Itga8 UTSW 2 12,115,895 (GRCm39) missense probably damaging 0.99
R7203:Itga8 UTSW 2 12,234,906 (GRCm39) missense possibly damaging 0.77
R7266:Itga8 UTSW 2 12,237,712 (GRCm39) missense probably damaging 1.00
R7323:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R7540:Itga8 UTSW 2 12,115,848 (GRCm39) missense possibly damaging 0.82
R7637:Itga8 UTSW 2 12,113,998 (GRCm39) missense probably damaging 1.00
R7748:Itga8 UTSW 2 12,235,050 (GRCm39) missense possibly damaging 0.80
R7848:Itga8 UTSW 2 12,196,548 (GRCm39) missense probably damaging 0.99
R8031:Itga8 UTSW 2 12,160,297 (GRCm39) missense probably benign
R8077:Itga8 UTSW 2 12,247,244 (GRCm39) missense probably benign 0.09
R8757:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8759:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8772:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8773:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8808:Itga8 UTSW 2 12,137,328 (GRCm39) nonsense probably null
R8898:Itga8 UTSW 2 12,145,206 (GRCm39) missense probably benign 0.05
R9056:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R9155:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R9354:Itga8 UTSW 2 12,237,668 (GRCm39) missense possibly damaging 0.94
R9563:Itga8 UTSW 2 12,165,219 (GRCm39) missense possibly damaging 0.83
R9589:Itga8 UTSW 2 12,237,701 (GRCm39) missense probably damaging 1.00
R9663:Itga8 UTSW 2 12,196,580 (GRCm39) missense probably benign 0.00
Z1176:Itga8 UTSW 2 12,306,643 (GRCm39) start gained probably benign
Z1176:Itga8 UTSW 2 12,266,947 (GRCm39) missense probably benign 0.01
Z1176:Itga8 UTSW 2 12,252,329 (GRCm39) missense probably damaging 1.00
Z1177:Itga8 UTSW 2 12,305,744 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGAAATCCCCGAGTCACTTTC -3'
(R):5'- GAGCATCATCTACAGACATCTCAG -3'

Sequencing Primer
(F):5'- CGAGTCACTTTCCCGCC -3'
(R):5'- TCATCTACAGACATCTCAGAACAATC -3'
Posted On 2021-08-31