Incidental Mutation 'R8962:Vmn2r6'
ID 682375
Institutional Source Beutler Lab
Gene Symbol Vmn2r6
Ensembl Gene ENSMUSG00000090581
Gene Name vomeronasal 2, receptor 6
Synonyms EG620718, EG667069
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock # R8962 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 64537561-64565298 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 64556155 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 419 (D419E)
Ref Sequence ENSEMBL: ENSMUSP00000135148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165012] [ENSMUST00000176481]
AlphaFold H3BK29
Predicted Effect probably damaging
Transcript: ENSMUST00000165012
AA Change: D330E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131831
Gene: ENSMUSG00000090581
AA Change: D330E

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 1.4e-72 PFAM
Pfam:Peripla_BP_6 58 244 1.2e-10 PFAM
Pfam:NCD3G 458 511 1.8e-17 PFAM
Pfam:7tm_3 542 779 3.9e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176481
AA Change: D419E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135148
Gene: ENSMUSG00000090581
AA Change: D419E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 88 505 9.8e-77 PFAM
Pfam:Peripla_BP_6 142 331 3.4e-10 PFAM
Pfam:NCD3G 547 600 5.4e-17 PFAM
Pfam:7tm_3 633 867 3.9e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 99% (86/87)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik T A 9: 46,308,875 M120L probably benign Het
6430573F11Rik A G 8: 36,505,575 K60E probably damaging Het
Abat A G 16: 8,578,302 T48A probably damaging Het
Abca8a A T 11: 110,078,808 I314N probably damaging Het
Abr A T 11: 76,461,329 V108D probably damaging Het
Adamts17 T G 7: 67,075,309 L162V probably damaging Het
Adamts6 A T 13: 104,297,391 K109N probably damaging Het
Ago3 A G 4: 126,347,802 F68S probably damaging Het
Aifm3 T C 16: 17,506,336 probably null Het
Ankrd26 T C 6: 118,535,143 E506G probably benign Het
Apaf1 A G 10: 91,067,204 L185P probably damaging Het
Atp8b3 G T 10: 80,520,062 T1272K probably benign Het
Cars2 A G 8: 11,537,304 V193A probably benign Het
Ccr8 A T 9: 120,094,547 I243F possibly damaging Het
Col12a1 A G 9: 79,631,619 V2465A probably damaging Het
Ctbp1 T C 5: 33,259,272 N127S probably benign Het
Ddx10 A G 9: 53,238,077 S117P probably damaging Het
Dgkb T C 12: 38,139,495 probably null Het
Dnah11 T A 12: 117,952,538 D3520V probably damaging Het
Dnah11 C T 12: 117,954,895 D1530N probably damaging Het
Dock5 T C 14: 67,757,191 T1807A probably benign Het
Drd3 C T 16: 43,821,479 T386I probably damaging Het
Dsg1b A G 18: 20,409,259 N941S probably damaging Het
Enpp3 T C 10: 24,820,615 T141A probably benign Het
Esyt1 A T 10: 128,520,697 C360S possibly damaging Het
Ethe1 T A 7: 24,606,257 V143D probably damaging Het
Fam170b A G 14: 32,835,379 D57G probably benign Het
Fam53c T C 18: 34,768,176 S49P probably damaging Het
Fbp1 G A 13: 62,875,253 L77F probably benign Het
Gm10471 T G 5: 26,085,747 E142A probably benign Het
Gm17093 A G 14: 44,520,692 E110G Het
Gm21976 G T 13: 98,287,313 silent Het
Golgb1 T C 16: 36,913,616 I1075T probably damaging Het
Grip2 T C 6: 91,777,410 D628G probably damaging Het
Gtpbp1 G T 15: 79,717,728 L557F probably benign Het
Ighv12-3 A T 12: 114,366,584 F97Y probably benign Het
Itga8 T C 2: 12,191,234 H635R possibly damaging Het
Itgb7 A G 15: 102,218,602 L466S probably damaging Het
Klc2 T C 19: 5,111,836 D277G probably benign Het
Ktn1 A G 14: 47,663,791 E2G probably damaging Het
Lcmt1 T A 7: 123,401,446 Y68N probably damaging Het
March10 G T 11: 105,389,989 S490* probably null Het
Mterf1b A T 5: 4,196,437 Y26F probably benign Het
Myo18b T A 5: 112,858,480 I855F probably benign Het
Nek4 G A 14: 30,953,958 M83I probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nos1 T C 5: 117,879,340 V256A probably benign Het
Nr1h2 T C 7: 44,552,039 T50A probably benign Het
Olfr296-ps1 T A 7: 86,562,109 *126K probably null Het
Olfr732 A C 14: 50,281,359 M298R possibly damaging Het
Ovol2 G C 2: 144,305,914 R172G probably damaging Het
Parp14 A G 16: 35,856,817 I927T probably damaging Het
Pcdhga7 T A 18: 37,715,826 H295Q probably benign Het
Pkhd1l1 C T 15: 44,536,895 T2145I probably damaging Het
Plekhs1 C T 19: 56,473,248 T139I possibly damaging Het
Rab11fip3 T A 17: 26,012,033 D746V probably damaging Het
Rnf214 A C 9: 45,898,430 probably null Het
Rtn4ip1 A T 10: 43,946,419 probably null Het
S1pr1 T C 3: 115,711,920 R342G Het
Serpina1f T C 12: 103,689,872 S366G probably benign Het
Sestd1 A T 2: 77,212,364 M282K probably benign Het
Siglecf T G 7: 43,351,716 V36G probably damaging Het
Slc1a1 T C 19: 28,909,469 V410A probably damaging Het
Slc38a4 C A 15: 97,019,803 D14Y probably benign Het
Slk C T 19: 47,622,309 T806M probably damaging Het
Slurp2 C A 15: 74,743,400 V48F possibly damaging Het
Socs1 A G 16: 10,784,778 S32P possibly damaging Het
Son T C 16: 91,658,169 V1268A possibly damaging Het
Sp7 C A 15: 102,366,445 probably benign Het
Taar7b T G 10: 24,000,461 S175A probably benign Het
Tet2 T C 3: 133,488,043 N210S probably benign Het
Tkfc T C 19: 10,593,336 D492G probably damaging Het
Tmc7 G A 7: 118,561,005 P203L probably benign Het
Tshz2 C A 2: 169,884,604 F373L probably damaging Het
Ttc29 T A 8: 78,315,707 L307Q probably damaging Het
Tubd1 G A 11: 86,548,833 M1I probably null Het
Vmn1r62 T A 7: 5,675,602 M94K probably damaging Het
Vmn2r125 T C 4: 156,350,891 I188T possibly damaging Het
Vmn2r5 T C 3: 64,491,143 D805G probably damaging Het
Vps39 A T 2: 120,344,206 Y98* probably null Het
Wisp2 C T 2: 163,825,240 R54* probably null Het
Zdbf2 G A 1: 63,308,003 G1847D probably benign Het
Zdhhc6 T C 19: 55,298,807 E407G probably benign Het
Zfp407 A G 18: 84,558,932 I1352T probably damaging Het
Zfp607a A G 7: 27,879,361 K619E possibly damaging Het
Zfp811 A T 17: 32,798,648 N139K probably benign Het
Other mutations in Vmn2r6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Vmn2r6 APN 3 64538104 missense probably damaging 1.00
IGL01968:Vmn2r6 APN 3 64556345 missense possibly damaging 0.94
IGL02009:Vmn2r6 APN 3 64537902 missense possibly damaging 0.61
IGL02039:Vmn2r6 APN 3 64556189 missense probably damaging 1.00
IGL02652:Vmn2r6 APN 3 64556328 missense probably benign 0.24
IGL02737:Vmn2r6 APN 3 64556490 missense possibly damaging 0.55
IGL02808:Vmn2r6 APN 3 64556496 missense probably damaging 1.00
IGL03066:Vmn2r6 APN 3 64565153 missense probably damaging 0.99
IGL03331:Vmn2r6 APN 3 64538007 missense probably damaging 1.00
BB010:Vmn2r6 UTSW 3 64559803 missense probably benign 0.02
BB020:Vmn2r6 UTSW 3 64559803 missense probably benign 0.02
R0010:Vmn2r6 UTSW 3 64559545 nonsense probably null
R0206:Vmn2r6 UTSW 3 64539912 missense probably benign
R0206:Vmn2r6 UTSW 3 64539912 missense probably benign
R0208:Vmn2r6 UTSW 3 64539912 missense probably benign
R0427:Vmn2r6 UTSW 3 64559587 missense probably damaging 1.00
R0466:Vmn2r6 UTSW 3 64556302 missense probably damaging 1.00
R1018:Vmn2r6 UTSW 3 64556840 missense probably benign 0.00
R1104:Vmn2r6 UTSW 3 64538066 missense possibly damaging 0.93
R1186:Vmn2r6 UTSW 3 64565067 missense probably benign 0.01
R1245:Vmn2r6 UTSW 3 64556790 missense possibly damaging 0.53
R1295:Vmn2r6 UTSW 3 64538273 missense probably damaging 1.00
R1473:Vmn2r6 UTSW 3 64538158 nonsense probably null
R1498:Vmn2r6 UTSW 3 64556469 missense probably damaging 1.00
R1925:Vmn2r6 UTSW 3 64556277 missense possibly damaging 0.87
R2044:Vmn2r6 UTSW 3 64537841 missense probably damaging 0.96
R2069:Vmn2r6 UTSW 3 64556098 missense possibly damaging 0.89
R2253:Vmn2r6 UTSW 3 64559718 missense probably damaging 1.00
R2261:Vmn2r6 UTSW 3 64556669 missense probably benign 0.24
R2262:Vmn2r6 UTSW 3 64556669 missense probably benign 0.24
R2350:Vmn2r6 UTSW 3 64556352 missense probably benign 0.01
R2680:Vmn2r6 UTSW 3 64538286 missense possibly damaging 0.91
R2846:Vmn2r6 UTSW 3 64556790 missense possibly damaging 0.53
R2860:Vmn2r6 UTSW 3 64547339 missense probably benign 0.00
R2861:Vmn2r6 UTSW 3 64547339 missense probably benign 0.00
R3766:Vmn2r6 UTSW 3 64556508 missense probably benign 0.19
R3870:Vmn2r6 UTSW 3 64556621 missense probably damaging 0.96
R4018:Vmn2r6 UTSW 3 64556472 missense probably benign 0.05
R4024:Vmn2r6 UTSW 3 64538250 missense possibly damaging 0.73
R4026:Vmn2r6 UTSW 3 64538250 missense possibly damaging 0.73
R4227:Vmn2r6 UTSW 3 64537948 missense probably damaging 0.99
R4526:Vmn2r6 UTSW 3 64537724 missense probably benign 0.32
R4570:Vmn2r6 UTSW 3 64559647 missense probably benign 0.31
R4894:Vmn2r6 UTSW 3 64547408 missense probably benign
R4934:Vmn2r6 UTSW 3 64556345 missense probably damaging 0.99
R5057:Vmn2r6 UTSW 3 64537786 missense probably damaging 1.00
R5059:Vmn2r6 UTSW 3 64537623 missense possibly damaging 0.89
R5148:Vmn2r6 UTSW 3 64556594 missense probably damaging 0.99
R5155:Vmn2r6 UTSW 3 64538514 missense probably benign 0.44
R5179:Vmn2r6 UTSW 3 64537990 missense probably benign 0.00
R5256:Vmn2r6 UTSW 3 64556842 missense probably benign 0.33
R5861:Vmn2r6 UTSW 3 64556033 missense probably benign 0.00
R5950:Vmn2r6 UTSW 3 64565231 missense probably benign 0.05
R6081:Vmn2r6 UTSW 3 64556532 missense probably benign 0.25
R6173:Vmn2r6 UTSW 3 64559755 missense probably damaging 1.00
R6190:Vmn2r6 UTSW 3 64538003 missense probably benign 0.04
R6240:Vmn2r6 UTSW 3 64556805 missense probably damaging 1.00
R6433:Vmn2r6 UTSW 3 64547380 nonsense probably null
R6645:Vmn2r6 UTSW 3 64556876 missense probably damaging 1.00
R6791:Vmn2r6 UTSW 3 64538159 missense probably damaging 1.00
R7265:Vmn2r6 UTSW 3 64556774 missense probably benign 0.00
R7503:Vmn2r6 UTSW 3 64539951 nonsense probably null
R7562:Vmn2r6 UTSW 3 64556520 missense probably benign 0.00
R7584:Vmn2r6 UTSW 3 64565262 missense probably benign 0.07
R7611:Vmn2r6 UTSW 3 64565142 missense probably damaging 0.98
R7759:Vmn2r6 UTSW 3 64556570 missense probably damaging 1.00
R7834:Vmn2r6 UTSW 3 64538022 missense probably damaging 1.00
R7933:Vmn2r6 UTSW 3 64559803 missense probably benign 0.02
R7982:Vmn2r6 UTSW 3 64559820 missense probably damaging 1.00
R8024:Vmn2r6 UTSW 3 64559824 missense probably benign 0.40
R8074:Vmn2r6 UTSW 3 64547643 intron probably benign
R8169:Vmn2r6 UTSW 3 64539889 missense probably benign 0.01
R8337:Vmn2r6 UTSW 3 64556105 nonsense probably null
R8736:Vmn2r6 UTSW 3 64559800 missense probably damaging 1.00
R9139:Vmn2r6 UTSW 3 64556856 missense probably benign 0.12
R9206:Vmn2r6 UTSW 3 64559611 missense probably damaging 0.97
R9295:Vmn2r6 UTSW 3 64556063 missense probably benign 0.00
R9332:Vmn2r6 UTSW 3 64547250 missense probably benign 0.01
R9616:Vmn2r6 UTSW 3 64538303 missense probably damaging 1.00
R9663:Vmn2r6 UTSW 3 64556128 missense possibly damaging 0.90
R9685:Vmn2r6 UTSW 3 64556660 missense probably benign 0.19
X0020:Vmn2r6 UTSW 3 64538450 missense probably benign
X0066:Vmn2r6 UTSW 3 64547378 missense probably damaging 1.00
Z1176:Vmn2r6 UTSW 3 64556325 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCAGTTTCAGAGGTATGAACATAGGTG -3'
(R):5'- TGTCTTGACCATTGAATTCTGGC -3'

Sequencing Primer
(F):5'- GGTATGAACATAGGTGTAAACACTTG -3'
(R):5'- GGCAAACTGCTTTTAACTGTACCTGG -3'
Posted On 2021-08-31