Incidental Mutation 'R8962:Vmn2r6'
ID 682375
Institutional Source Beutler Lab
Gene Symbol Vmn2r6
Ensembl Gene ENSMUSG00000090581
Gene Name vomeronasal 2, receptor 6
Synonyms EG667069, EG620718
MMRRC Submission 068796-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.198) question?
Stock # R8962 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 64444916-64472855 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 64463576 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 419 (D419E)
Ref Sequence ENSEMBL: ENSMUSP00000135148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165012] [ENSMUST00000176481]
AlphaFold H3BK29
Predicted Effect probably damaging
Transcript: ENSMUST00000165012
AA Change: D330E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131831
Gene: ENSMUSG00000090581
AA Change: D330E

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 1.4e-72 PFAM
Pfam:Peripla_BP_6 58 244 1.2e-10 PFAM
Pfam:NCD3G 458 511 1.8e-17 PFAM
Pfam:7tm_3 542 779 3.9e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176481
AA Change: D419E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135148
Gene: ENSMUSG00000090581
AA Change: D419E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 88 505 9.8e-77 PFAM
Pfam:Peripla_BP_6 142 331 3.4e-10 PFAM
Pfam:NCD3G 547 600 5.4e-17 PFAM
Pfam:7tm_3 633 867 3.9e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 99% (86/87)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik T A 9: 46,220,173 (GRCm39) M120L probably benign Het
Abat A G 16: 8,396,166 (GRCm39) T48A probably damaging Het
Abca8a A T 11: 109,969,634 (GRCm39) I314N probably damaging Het
Abr A T 11: 76,352,155 (GRCm39) V108D probably damaging Het
Adamts17 T G 7: 66,725,057 (GRCm39) L162V probably damaging Het
Adamts6 A T 13: 104,433,899 (GRCm39) K109N probably damaging Het
Ago3 A G 4: 126,241,595 (GRCm39) F68S probably damaging Het
Aifm3 T C 16: 17,324,200 (GRCm39) probably null Het
Ankrd26 T C 6: 118,512,104 (GRCm39) E506G probably benign Het
Apaf1 A G 10: 90,903,066 (GRCm39) L185P probably damaging Het
Atp8b3 G T 10: 80,355,896 (GRCm39) T1272K probably benign Het
Cars2 A G 8: 11,587,304 (GRCm39) V193A probably benign Het
Ccn5 C T 2: 163,667,160 (GRCm39) R54* probably null Het
Ccr8 A T 9: 119,923,613 (GRCm39) I243F possibly damaging Het
Col12a1 A G 9: 79,538,901 (GRCm39) V2465A probably damaging Het
Ctbp1 T C 5: 33,416,616 (GRCm39) N127S probably benign Het
Ddx10 A G 9: 53,149,377 (GRCm39) S117P probably damaging Het
Dgkb T C 12: 38,189,494 (GRCm39) probably null Het
Dnah11 T A 12: 117,916,273 (GRCm39) D3520V probably damaging Het
Dnah11 C T 12: 117,918,630 (GRCm39) D1530N probably damaging Het
Dock5 T C 14: 67,994,640 (GRCm39) T1807A probably benign Het
Drd3 C T 16: 43,641,842 (GRCm39) T386I probably damaging Het
Dsg1b A G 18: 20,542,316 (GRCm39) N941S probably damaging Het
Enpp3 T C 10: 24,696,513 (GRCm39) T141A probably benign Het
Esyt1 A T 10: 128,356,566 (GRCm39) C360S possibly damaging Het
Ethe1 T A 7: 24,305,682 (GRCm39) V143D probably damaging Het
Fam170b A G 14: 32,557,336 (GRCm39) D57G probably benign Het
Fam53c T C 18: 34,901,229 (GRCm39) S49P probably damaging Het
Fbp1 G A 13: 63,023,067 (GRCm39) L77F probably benign Het
Gm17093 A G 14: 44,758,149 (GRCm39) E110G Het
Gm21976 G T 13: 98,423,821 (GRCm39) silent Het
Golgb1 T C 16: 36,733,978 (GRCm39) I1075T probably damaging Het
Grip2 T C 6: 91,754,391 (GRCm39) D628G probably damaging Het
Gtpbp1 G T 15: 79,601,929 (GRCm39) L557F probably benign Het
Ighv12-3 A T 12: 114,330,204 (GRCm39) F97Y probably benign Het
Itga8 T C 2: 12,196,045 (GRCm39) H635R possibly damaging Het
Itgb7 A G 15: 102,127,037 (GRCm39) L466S probably damaging Het
Klc2 T C 19: 5,161,864 (GRCm39) D277G probably benign Het
Ktn1 A G 14: 47,901,248 (GRCm39) E2G probably damaging Het
Lcmt1 T A 7: 123,000,669 (GRCm39) Y68N probably damaging Het
Marchf10 G T 11: 105,280,815 (GRCm39) S490* probably null Het
Mterf1b A T 5: 4,246,437 (GRCm39) Y26F probably benign Het
Myo18b T A 5: 113,006,346 (GRCm39) I855F probably benign Het
Nek4 G A 14: 30,675,915 (GRCm39) M83I probably damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nos1 T C 5: 118,017,405 (GRCm39) V256A probably benign Het
Nr1h2 T C 7: 44,201,463 (GRCm39) T50A probably benign Het
Or14c42-ps1 T A 7: 86,211,317 (GRCm39) *126K probably null Het
Or4n4 A C 14: 50,518,816 (GRCm39) M298R possibly damaging Het
Ovol2 G C 2: 144,147,834 (GRCm39) R172G probably damaging Het
Parp14 A G 16: 35,677,187 (GRCm39) I927T probably damaging Het
Pcdhga7 T A 18: 37,848,879 (GRCm39) H295Q probably benign Het
Pkhd1l1 C T 15: 44,400,291 (GRCm39) T2145I probably damaging Het
Plekhs1 C T 19: 56,461,680 (GRCm39) T139I possibly damaging Het
Rab11fip3 T A 17: 26,231,007 (GRCm39) D746V probably damaging Het
Rnf214 A C 9: 45,809,728 (GRCm39) probably null Het
Rtn4ip1 A T 10: 43,822,415 (GRCm39) probably null Het
S1pr1 T C 3: 115,505,569 (GRCm39) R342G Het
Serpina1f T C 12: 103,656,131 (GRCm39) S366G probably benign Het
Sestd1 A T 2: 77,042,708 (GRCm39) M282K probably benign Het
Siglecf T G 7: 43,001,140 (GRCm39) V36G probably damaging Het
Slc1a1 T C 19: 28,886,869 (GRCm39) V410A probably damaging Het
Slc38a4 C A 15: 96,917,684 (GRCm39) D14Y probably benign Het
Slk C T 19: 47,610,748 (GRCm39) T806M probably damaging Het
Slurp2 C A 15: 74,615,249 (GRCm39) V48F possibly damaging Het
Socs1 A G 16: 10,602,642 (GRCm39) S32P possibly damaging Het
Son T C 16: 91,455,057 (GRCm39) V1268A possibly damaging Het
Sp7 C A 15: 102,274,880 (GRCm39) probably benign Het
Speer4a2 T G 5: 26,290,745 (GRCm39) E142A probably benign Het
Taar7b T G 10: 23,876,359 (GRCm39) S175A probably benign Het
Tet2 T C 3: 133,193,804 (GRCm39) N210S probably benign Het
Tkfc T C 19: 10,570,700 (GRCm39) D492G probably damaging Het
Tmc7 G A 7: 118,160,228 (GRCm39) P203L probably benign Het
Trmt9b A G 8: 36,972,729 (GRCm39) K60E probably damaging Het
Tshz2 C A 2: 169,726,524 (GRCm39) F373L probably damaging Het
Ttc29 T A 8: 79,042,336 (GRCm39) L307Q probably damaging Het
Tubd1 G A 11: 86,439,659 (GRCm39) M1I probably null Het
Vmn1r62 T A 7: 5,678,601 (GRCm39) M94K probably damaging Het
Vmn2r125 T C 4: 156,703,186 (GRCm39) I188T possibly damaging Het
Vmn2r5 T C 3: 64,398,564 (GRCm39) D805G probably damaging Het
Vps39 A T 2: 120,174,687 (GRCm39) Y98* probably null Het
Zdbf2 G A 1: 63,347,162 (GRCm39) G1847D probably benign Het
Zdhhc6 T C 19: 55,287,239 (GRCm39) E407G probably benign Het
Zfp407 A G 18: 84,577,057 (GRCm39) I1352T probably damaging Het
Zfp607a A G 7: 27,578,786 (GRCm39) K619E possibly damaging Het
Zfp811 A T 17: 33,017,622 (GRCm39) N139K probably benign Het
Other mutations in Vmn2r6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Vmn2r6 APN 3 64,445,525 (GRCm39) missense probably damaging 1.00
IGL01968:Vmn2r6 APN 3 64,463,766 (GRCm39) missense possibly damaging 0.94
IGL02009:Vmn2r6 APN 3 64,445,323 (GRCm39) missense possibly damaging 0.61
IGL02039:Vmn2r6 APN 3 64,463,610 (GRCm39) missense probably damaging 1.00
IGL02652:Vmn2r6 APN 3 64,463,749 (GRCm39) missense probably benign 0.24
IGL02737:Vmn2r6 APN 3 64,463,911 (GRCm39) missense possibly damaging 0.55
IGL02808:Vmn2r6 APN 3 64,463,917 (GRCm39) missense probably damaging 1.00
IGL03066:Vmn2r6 APN 3 64,472,574 (GRCm39) missense probably damaging 0.99
IGL03331:Vmn2r6 APN 3 64,445,428 (GRCm39) missense probably damaging 1.00
BB010:Vmn2r6 UTSW 3 64,467,224 (GRCm39) missense probably benign 0.02
BB020:Vmn2r6 UTSW 3 64,467,224 (GRCm39) missense probably benign 0.02
R0010:Vmn2r6 UTSW 3 64,466,966 (GRCm39) nonsense probably null
R0206:Vmn2r6 UTSW 3 64,447,333 (GRCm39) missense probably benign
R0206:Vmn2r6 UTSW 3 64,447,333 (GRCm39) missense probably benign
R0208:Vmn2r6 UTSW 3 64,447,333 (GRCm39) missense probably benign
R0427:Vmn2r6 UTSW 3 64,467,008 (GRCm39) missense probably damaging 1.00
R0466:Vmn2r6 UTSW 3 64,463,723 (GRCm39) missense probably damaging 1.00
R1018:Vmn2r6 UTSW 3 64,464,261 (GRCm39) missense probably benign 0.00
R1104:Vmn2r6 UTSW 3 64,445,487 (GRCm39) missense possibly damaging 0.93
R1186:Vmn2r6 UTSW 3 64,472,488 (GRCm39) missense probably benign 0.01
R1245:Vmn2r6 UTSW 3 64,464,211 (GRCm39) missense possibly damaging 0.53
R1295:Vmn2r6 UTSW 3 64,445,694 (GRCm39) missense probably damaging 1.00
R1473:Vmn2r6 UTSW 3 64,445,579 (GRCm39) nonsense probably null
R1498:Vmn2r6 UTSW 3 64,463,890 (GRCm39) missense probably damaging 1.00
R1925:Vmn2r6 UTSW 3 64,463,698 (GRCm39) missense possibly damaging 0.87
R2044:Vmn2r6 UTSW 3 64,445,262 (GRCm39) missense probably damaging 0.96
R2069:Vmn2r6 UTSW 3 64,463,519 (GRCm39) missense possibly damaging 0.89
R2253:Vmn2r6 UTSW 3 64,467,139 (GRCm39) missense probably damaging 1.00
R2261:Vmn2r6 UTSW 3 64,464,090 (GRCm39) missense probably benign 0.24
R2262:Vmn2r6 UTSW 3 64,464,090 (GRCm39) missense probably benign 0.24
R2350:Vmn2r6 UTSW 3 64,463,773 (GRCm39) missense probably benign 0.01
R2680:Vmn2r6 UTSW 3 64,445,707 (GRCm39) missense possibly damaging 0.91
R2846:Vmn2r6 UTSW 3 64,464,211 (GRCm39) missense possibly damaging 0.53
R2860:Vmn2r6 UTSW 3 64,454,760 (GRCm39) missense probably benign 0.00
R2861:Vmn2r6 UTSW 3 64,454,760 (GRCm39) missense probably benign 0.00
R3766:Vmn2r6 UTSW 3 64,463,929 (GRCm39) missense probably benign 0.19
R3870:Vmn2r6 UTSW 3 64,464,042 (GRCm39) missense probably damaging 0.96
R4018:Vmn2r6 UTSW 3 64,463,893 (GRCm39) missense probably benign 0.05
R4024:Vmn2r6 UTSW 3 64,445,671 (GRCm39) missense possibly damaging 0.73
R4026:Vmn2r6 UTSW 3 64,445,671 (GRCm39) missense possibly damaging 0.73
R4227:Vmn2r6 UTSW 3 64,445,369 (GRCm39) missense probably damaging 0.99
R4526:Vmn2r6 UTSW 3 64,445,145 (GRCm39) missense probably benign 0.32
R4570:Vmn2r6 UTSW 3 64,467,068 (GRCm39) missense probably benign 0.31
R4894:Vmn2r6 UTSW 3 64,454,829 (GRCm39) missense probably benign
R4934:Vmn2r6 UTSW 3 64,463,766 (GRCm39) missense probably damaging 0.99
R5057:Vmn2r6 UTSW 3 64,445,207 (GRCm39) missense probably damaging 1.00
R5059:Vmn2r6 UTSW 3 64,445,044 (GRCm39) missense possibly damaging 0.89
R5148:Vmn2r6 UTSW 3 64,464,015 (GRCm39) missense probably damaging 0.99
R5155:Vmn2r6 UTSW 3 64,445,935 (GRCm39) missense probably benign 0.44
R5179:Vmn2r6 UTSW 3 64,445,411 (GRCm39) missense probably benign 0.00
R5256:Vmn2r6 UTSW 3 64,464,263 (GRCm39) missense probably benign 0.33
R5861:Vmn2r6 UTSW 3 64,463,454 (GRCm39) missense probably benign 0.00
R5950:Vmn2r6 UTSW 3 64,472,652 (GRCm39) missense probably benign 0.05
R6081:Vmn2r6 UTSW 3 64,463,953 (GRCm39) missense probably benign 0.25
R6173:Vmn2r6 UTSW 3 64,467,176 (GRCm39) missense probably damaging 1.00
R6190:Vmn2r6 UTSW 3 64,445,424 (GRCm39) missense probably benign 0.04
R6240:Vmn2r6 UTSW 3 64,464,226 (GRCm39) missense probably damaging 1.00
R6433:Vmn2r6 UTSW 3 64,454,801 (GRCm39) nonsense probably null
R6645:Vmn2r6 UTSW 3 64,464,297 (GRCm39) missense probably damaging 1.00
R6791:Vmn2r6 UTSW 3 64,445,580 (GRCm39) missense probably damaging 1.00
R7265:Vmn2r6 UTSW 3 64,464,195 (GRCm39) missense probably benign 0.00
R7503:Vmn2r6 UTSW 3 64,447,372 (GRCm39) nonsense probably null
R7562:Vmn2r6 UTSW 3 64,463,941 (GRCm39) missense probably benign 0.00
R7584:Vmn2r6 UTSW 3 64,472,683 (GRCm39) missense probably benign 0.07
R7611:Vmn2r6 UTSW 3 64,472,563 (GRCm39) missense probably damaging 0.98
R7759:Vmn2r6 UTSW 3 64,463,991 (GRCm39) missense probably damaging 1.00
R7834:Vmn2r6 UTSW 3 64,445,443 (GRCm39) missense probably damaging 1.00
R7933:Vmn2r6 UTSW 3 64,467,224 (GRCm39) missense probably benign 0.02
R7982:Vmn2r6 UTSW 3 64,467,241 (GRCm39) missense probably damaging 1.00
R8024:Vmn2r6 UTSW 3 64,467,245 (GRCm39) missense probably benign 0.40
R8074:Vmn2r6 UTSW 3 64,455,064 (GRCm39) intron probably benign
R8169:Vmn2r6 UTSW 3 64,447,310 (GRCm39) missense probably benign 0.01
R8337:Vmn2r6 UTSW 3 64,463,526 (GRCm39) nonsense probably null
R8736:Vmn2r6 UTSW 3 64,467,221 (GRCm39) missense probably damaging 1.00
R9139:Vmn2r6 UTSW 3 64,464,277 (GRCm39) missense probably benign 0.12
R9206:Vmn2r6 UTSW 3 64,467,032 (GRCm39) missense probably damaging 0.97
R9295:Vmn2r6 UTSW 3 64,463,484 (GRCm39) missense probably benign 0.00
R9332:Vmn2r6 UTSW 3 64,454,671 (GRCm39) missense probably benign 0.01
R9616:Vmn2r6 UTSW 3 64,445,724 (GRCm39) missense probably damaging 1.00
R9663:Vmn2r6 UTSW 3 64,463,549 (GRCm39) missense possibly damaging 0.90
R9685:Vmn2r6 UTSW 3 64,464,081 (GRCm39) missense probably benign 0.19
X0020:Vmn2r6 UTSW 3 64,445,871 (GRCm39) missense probably benign
X0066:Vmn2r6 UTSW 3 64,454,799 (GRCm39) missense probably damaging 1.00
Z1176:Vmn2r6 UTSW 3 64,463,746 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCAGTTTCAGAGGTATGAACATAGGTG -3'
(R):5'- TGTCTTGACCATTGAATTCTGGC -3'

Sequencing Primer
(F):5'- GGTATGAACATAGGTGTAAACACTTG -3'
(R):5'- GGCAAACTGCTTTTAACTGTACCTGG -3'
Posted On 2021-08-31