Mutagenetix > Incidental Mutation

Incidental Mutation 'R8962:Tet2'

682377

Institutional Source

Beutler Lab

Gene Symbol

Tet2

Ensembl Gene

ENSMUSG00000040943

Gene Name

tet methylcytosine dioxygenase 2

Synonyms

E130014J05Rik, Ayu17-449

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_001040400.2; MGI:2443298

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8962 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

133463679-133545139 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 133488043 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 210 (N210S)

Ref Sequence

ENSEMBL: ENSMUSP00000096203 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098603] [ENSMUST00000196398] [ENSMUST00000197118]

AlphaFold

Q4JK59

Predicted Effect

probably benign
Transcript: ENSMUST00000098603
AA Change: N210S

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000096203
Gene: ENSMUSG00000040943
AA Change: N210S

Domain	Start	End	E-Value	Type
low complexity region	690	701	N/A	INTRINSIC
low complexity region	855	862	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	899	921	N/A	INTRINSIC
Tet_JBP	1203	1819	7e-301	SMART
low complexity region	1832	1844	N/A	INTRINSIC
low complexity region	1885	1897	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000196398
AA Change: N210S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000143029
Gene: ENSMUSG00000040943
AA Change: N210S

Domain	Start	End	E-Value	Type
low complexity region	690	701	N/A	INTRINSIC
low complexity region	855	862	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	899	921	N/A	INTRINSIC
Tet_JBP	1211	1827	3.4e-305	SMART
low complexity region	1840	1852	N/A	INTRINSIC
low complexity region	1893	1905	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000197118

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.4%

Validation Efficiency

99% (86/87)

MGI Phenotype

Strain: 5285413; 4345275; 3813933; 5301343
Lethality: D1-D2
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a methylcytosine dioxygenase that catalyzes the conversion of methylcytosine to 5-hydroxymethylcytosine. The encoded protein is involved in myelopoiesis, and defects in this gene have been associated with several myeloproliferative disorders. Two variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele die shortly after birth and exhibit a loss of acidic granules in the proximal convoluted tubules of the kidneys. Mice homozygous for a conditional allele activated in hematopoeitic compartment exhibit self-renewal and myeloid transforamtion. [provided by MGI curators]

Allele List at MGI

All alleles(1246) : Targeted(6) Gene trapped(1240)

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931429L15Rik	T	A	9: 46,308,875	M120L	probably benign	Het
6430573F11Rik	A	G	8: 36,505,575	K60E	probably damaging	Het
Abat	A	G	16: 8,578,302	T48A	probably damaging	Het
Abca8a	A	T	11: 110,078,808	I314N	probably damaging	Het
Abr	A	T	11: 76,461,329	V108D	probably damaging	Het
Adamts17	T	G	7: 67,075,309	L162V	probably damaging	Het
Adamts6	A	T	13: 104,297,391	K109N	probably damaging	Het
Ago3	A	G	4: 126,347,802	F68S	probably damaging	Het
Aifm3	T	C	16: 17,506,336		probably null	Het
Ankrd26	T	C	6: 118,535,143	E506G	probably benign	Het
Apaf1	A	G	10: 91,067,204	L185P	probably damaging	Het
Atp8b3	G	T	10: 80,520,062	T1272K	probably benign	Het
Cars2	A	G	8: 11,537,304	V193A	probably benign	Het
Ccr8	A	T	9: 120,094,547	I243F	possibly damaging	Het
Col12a1	A	G	9: 79,631,619	V2465A	probably damaging	Het
Ctbp1	T	C	5: 33,259,272	N127S	probably benign	Het
Ddx10	A	G	9: 53,238,077	S117P	probably damaging	Het
Dgkb	T	C	12: 38,139,495		probably null	Het
Dnah11	T	A	12: 117,952,538	D3520V	probably damaging	Het
Dnah11	C	T	12: 117,954,895	D1530N	probably damaging	Het
Dock5	T	C	14: 67,757,191	T1807A	probably benign	Het
Drd3	C	T	16: 43,821,479	T386I	probably damaging	Het
Dsg1b	A	G	18: 20,409,259	N941S	probably damaging	Het
Enpp3	T	C	10: 24,820,615	T141A	probably benign	Het
Esyt1	A	T	10: 128,520,697	C360S	possibly damaging	Het
Ethe1	T	A	7: 24,606,257	V143D	probably damaging	Het
Fam170b	A	G	14: 32,835,379	D57G	probably benign	Het
Fam53c	T	C	18: 34,768,176	S49P	probably damaging	Het
Fbp1	G	A	13: 62,875,253	L77F	probably benign	Het
Gm10471	T	G	5: 26,085,747	E142A	probably benign	Het
Gm17093	A	G	14: 44,520,692	E110G		Het
Gm21976	G	T	13: 98,287,313		silent	Het
Golgb1	T	C	16: 36,913,616	I1075T	probably damaging	Het
Grip2	T	C	6: 91,777,410	D628G	probably damaging	Het
Gtpbp1	G	T	15: 79,717,728	L557F	probably benign	Het
Ighv12-3	A	T	12: 114,366,584	F97Y	probably benign	Het
Itga8	T	C	2: 12,191,234	H635R	possibly damaging	Het
Itgb7	A	G	15: 102,218,602	L466S	probably damaging	Het
Klc2	T	C	19: 5,111,836	D277G	probably benign	Het
Ktn1	A	G	14: 47,663,791	E2G	probably damaging	Het
Lcmt1	T	A	7: 123,401,446	Y68N	probably damaging	Het
March10	G	T	11: 105,389,989	S490*	probably null	Het
Mterf1b	A	T	5: 4,196,437	Y26F	probably benign	Het
Myo18b	T	A	5: 112,858,480	I855F	probably benign	Het
Nek4	G	A	14: 30,953,958	M83I	probably damaging	Het
Nicn1	C	T	9: 108,294,509	R163C	possibly damaging	Het
Nos1	T	C	5: 117,879,340	V256A	probably benign	Het
Nr1h2	T	C	7: 44,552,039	T50A	probably benign	Het
Olfr296-ps1	T	A	7: 86,562,109	*126K	probably null	Het
Olfr732	A	C	14: 50,281,359	M298R	possibly damaging	Het
Ovol2	G	C	2: 144,305,914	R172G	probably damaging	Het
Parp14	A	G	16: 35,856,817	I927T	probably damaging	Het
Pcdhga7	T	A	18: 37,715,826	H295Q	probably benign	Het
Pkhd1l1	C	T	15: 44,536,895	T2145I	probably damaging	Het
Plekhs1	C	T	19: 56,473,248	T139I	possibly damaging	Het
Rab11fip3	T	A	17: 26,012,033	D746V	probably damaging	Het
Rnf214	A	C	9: 45,898,430		probably null	Het
Rtn4ip1	A	T	10: 43,946,419		probably null	Het
S1pr1	T	C	3: 115,711,920	R342G		Het
Serpina1f	T	C	12: 103,689,872	S366G	probably benign	Het
Sestd1	A	T	2: 77,212,364	M282K	probably benign	Het
Siglecf	T	G	7: 43,351,716	V36G	probably damaging	Het
Slc1a1	T	C	19: 28,909,469	V410A	probably damaging	Het
Slc38a4	C	A	15: 97,019,803	D14Y	probably benign	Het
Slk	C	T	19: 47,622,309	T806M	probably damaging	Het
Slurp2	C	A	15: 74,743,400	V48F	possibly damaging	Het
Socs1	A	G	16: 10,784,778	S32P	possibly damaging	Het
Son	T	C	16: 91,658,169	V1268A	possibly damaging	Het
Sp7	C	A	15: 102,366,445		probably benign	Het
Taar7b	T	G	10: 24,000,461	S175A	probably benign	Het
Tkfc	T	C	19: 10,593,336	D492G	probably damaging	Het
Tmc7	G	A	7: 118,561,005	P203L	probably benign	Het
Tshz2	C	A	2: 169,884,604	F373L	probably damaging	Het
Ttc29	T	A	8: 78,315,707	L307Q	probably damaging	Het
Tubd1	G	A	11: 86,548,833	M1I	probably null	Het
Vmn1r62	T	A	7: 5,675,602	M94K	probably damaging	Het
Vmn2r125	T	C	4: 156,350,891	I188T	possibly damaging	Het
Vmn2r5	T	C	3: 64,491,143	D805G	probably damaging	Het
Vmn2r6	A	T	3: 64,556,155	D419E	probably damaging	Het
Vps39	A	T	2: 120,344,206	Y98*	probably null	Het
Wisp2	C	T	2: 163,825,240	R54*	probably null	Het
Zdbf2	G	A	1: 63,308,003	G1847D	probably benign	Het
Zdhhc6	T	C	19: 55,298,807	E407G	probably benign	Het
Zfp407	A	G	18: 84,558,932	I1352T	probably damaging	Het
Zfp607a	A	G	7: 27,879,361	K619E	possibly damaging	Het
Zfp811	A	T	17: 32,798,648	N139K	probably benign	Het

Other mutations in Tet2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Tet2	APN	3	133488085	missense	possibly damaging	0.96
IGL00401:Tet2	APN	3	133466882	missense	possibly damaging	0.72
IGL01528:Tet2	APN	3	133480298	missense	possibly damaging	0.86
IGL02053:Tet2	APN	3	133488523	missense	possibly damaging	0.96
IGL02142:Tet2	APN	3	133480139	missense	possibly damaging	0.96
IGL02512:Tet2	APN	3	133469308	missense	probably benign	0.05
IGL03148:Tet2	APN	3	133481363	missense	probably benign	0.18
IGL03182:Tet2	APN	3	133471398	nonsense	probably null
IGL03371:Tet2	APN	3	133467551	missense	possibly damaging	0.71
P0022:Tet2	UTSW	3	133486893	missense	probably benign	0.01
P0023:Tet2	UTSW	3	133486893	missense	probably benign	0.01
P0031:Tet2	UTSW	3	133480202	missense	possibly damaging	0.53
R0012:Tet2	UTSW	3	133476558	missense	probably damaging	0.98
R0012:Tet2	UTSW	3	133476558	missense	probably damaging	0.98
R0463:Tet2	UTSW	3	133486666	missense	possibly damaging	0.86
R0522:Tet2	UTSW	3	133466804	missense	probably damaging	0.98
R0593:Tet2	UTSW	3	133488109	missense	probably benign	0.00
R0600:Tet2	UTSW	3	133467602	missense	probably benign	0.00
R0600:Tet2	UTSW	3	133467725	missense	probably benign	0.01
R0698:Tet2	UTSW	3	133467384	missense	probably benign	0.32
R0723:Tet2	UTSW	3	133467284	missense	probably benign
R0726:Tet2	UTSW	3	133468184	missense	probably benign
R0747:Tet2	UTSW	3	133467470	missense	possibly damaging	0.86
R1006:Tet2	UTSW	3	133476601	missense	possibly damaging	0.53
R1382:Tet2	UTSW	3	133476615	missense	probably damaging	1.00
R1455:Tet2	UTSW	3	133473645	missense	possibly damaging	0.51
R1550:Tet2	UTSW	3	133469519	missense	probably benign	0.32
R1647:Tet2	UTSW	3	133485880	missense	probably benign
R1662:Tet2	UTSW	3	133466852	missense	possibly damaging	0.96
R1727:Tet2	UTSW	3	133487290	missense	probably damaging	0.98
R1738:Tet2	UTSW	3	133481387	missense	probably benign	0.08
R1749:Tet2	UTSW	3	133480131	critical splice donor site	probably null
R1869:Tet2	UTSW	3	133481441	splice site	probably null
R1887:Tet2	UTSW	3	133487333	missense	possibly damaging	0.68
R1937:Tet2	UTSW	3	133488638	missense	possibly damaging	0.68
R1939:Tet2	UTSW	3	133488638	missense	possibly damaging	0.68
R1940:Tet2	UTSW	3	133488638	missense	possibly damaging	0.68
R1997:Tet2	UTSW	3	133486589	nonsense	probably null
R2082:Tet2	UTSW	3	133485727	missense	possibly damaging	0.96
R2084:Tet2	UTSW	3	133487767	missense	possibly damaging	0.68
R2215:Tet2	UTSW	3	133486601	missense	probably benign	0.03
R2321:Tet2	UTSW	3	133486339	missense	possibly damaging	0.53
R2873:Tet2	UTSW	3	133486954	missense	probably damaging	1.00
R3439:Tet2	UTSW	3	133466831	missense	possibly damaging	0.93
R3783:Tet2	UTSW	3	133479363	missense	possibly damaging	0.53
R3894:Tet2	UTSW	3	133469477	missense	possibly damaging	0.86
R3916:Tet2	UTSW	3	133486055	missense	possibly damaging	0.53
R3966:Tet2	UTSW	3	133487657	missense	possibly damaging	0.73
R4457:Tet2	UTSW	3	133485563	missense	possibly damaging	0.85
R4633:Tet2	UTSW	3	133485549	missense	probably benign	0.33
R4646:Tet2	UTSW	3	133488082	missense	probably benign	0.02
R4647:Tet2	UTSW	3	133488082	missense	probably benign	0.02
R4648:Tet2	UTSW	3	133488082	missense	probably benign	0.02
R4691:Tet2	UTSW	3	133486083	missense	possibly damaging	0.73
R4805:Tet2	UTSW	3	133467315	missense	probably benign	0.32
R4829:Tet2	UTSW	3	133476620	missense	possibly damaging	0.91
R4901:Tet2	UTSW	3	133467044	missense	possibly damaging	0.86
R4975:Tet2	UTSW	3	133486759	unclassified	probably benign
R5004:Tet2	UTSW	3	133487379	missense	possibly damaging	0.84
R5075:Tet2	UTSW	3	133486906	missense	probably benign
R5137:Tet2	UTSW	3	133476565	missense	probably benign	0.32
R5324:Tet2	UTSW	3	133485913	missense	probably benign	0.00
R5590:Tet2	UTSW	3	133476480	splice site	probably null
R5854:Tet2	UTSW	3	133487885	missense	probably damaging	0.98
R5856:Tet2	UTSW	3	133486640	missense	probably benign	0.01
R5865:Tet2	UTSW	3	133487099	missense	probably benign	0.08
R5879:Tet2	UTSW	3	133487960	missense	possibly damaging	0.96
R5935:Tet2	UTSW	3	133488535	missense	possibly damaging	0.68
R6012:Tet2	UTSW	3	133466781	missense	possibly damaging	0.86
R6075:Tet2	UTSW	3	133471435	missense	possibly damaging	0.71
R6181:Tet2	UTSW	3	133487759	nonsense	probably null
R6188:Tet2	UTSW	3	133480326	missense	probably benign	0.18
R6339:Tet2	UTSW	3	133486417	missense	possibly damaging	0.53
R6612:Tet2	UTSW	3	133487335	missense	possibly damaging	0.53
R6923:Tet2	UTSW	3	133479341	critical splice donor site	probably null
R6934:Tet2	UTSW	3	133483237	critical splice donor site	probably null
R7076:Tet2	UTSW	3	133467023	missense	possibly damaging	0.71
R7155:Tet2	UTSW	3	133469591	missense	possibly damaging	0.71
R7184:Tet2	UTSW	3	133473630	missense	probably damaging	0.98
R7200:Tet2	UTSW	3	133487192	missense	probably benign	0.18
R7459:Tet2	UTSW	3	133480289	missense	possibly damaging	0.53
R7504:Tet2	UTSW	3	133487339	missense	probably benign	0.33
R7524:Tet2	UTSW	3	133480229	missense	probably benign	0.33
R7613:Tet2	UTSW	3	133466748	missense	possibly damaging	0.83
R7653:Tet2	UTSW	3	133486385	missense	probably benign	0.18
R7691:Tet2	UTSW	3	133486849	missense	probably damaging	0.98
R7770:Tet2	UTSW	3	133480295	missense	possibly damaging	0.53
R7807:Tet2	UTSW	3	133486541	missense	possibly damaging	0.53
R7813:Tet2	UTSW	3	133473643	missense	probably benign	0.06
R7978:Tet2	UTSW	3	133487665	missense	possibly damaging	0.96
R8055:Tet2	UTSW	3	133467992	missense	possibly damaging	0.93
R8164:Tet2	UTSW	3	133467134	missense	possibly damaging	0.85
R8236:Tet2	UTSW	3	133487786	missense	probably benign	0.00
R8755:Tet2	UTSW	3	133488278	missense	probably damaging	0.99
R9009:Tet2	UTSW	3	133487599	missense	possibly damaging	0.86
R9014:Tet2	UTSW	3	133467188	missense	probably damaging	0.99
R9128:Tet2	UTSW	3	133469613	missense	possibly damaging	0.85
R9166:Tet2	UTSW	3	133468172	missense	probably damaging	1.00
R9190:Tet2	UTSW	3	133481386	missense	possibly damaging	0.73
R9344:Tet2	UTSW	3	133469354	missense	possibly damaging	0.86
R9360:Tet2	UTSW	3	133487142	missense	possibly damaging	0.72
R9471:Tet2	UTSW	3	133485919	missense	probably damaging	1.00
R9488:Tet2	UTSW	3	133487342	missense	probably benign	0.18
R9534:Tet2	UTSW	3	133467928	nonsense	probably null
R9557:Tet2	UTSW	3	133485805	missense	probably benign
R9621:Tet2	UTSW	3	133488006	nonsense	probably null
R9644:Tet2	UTSW	3	133487303	nonsense	probably null
R9719:Tet2	UTSW	3	133486042	missense	possibly damaging	0.86
X0021:Tet2	UTSW	3	133486295	missense	possibly damaging	0.85
X0066:Tet2	UTSW	3	133488373	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- GCATCACAGGCCTTAGTCAC -3'
(R):5'- ACCACCCAGGAAAGTTCAGG -3'

Sequencing Primer
(F):5'- AGGCCTTAGTCACCATTGCAG -3'
(R):5'- AGGTGCAGATGCTTTCCCAAC -3'

Posted On

2021-08-31