Incidental Mutation 'R8962:Ago3'
ID 682378
Institutional Source Beutler Lab
Gene Symbol Ago3
Ensembl Gene ENSMUSG00000028842
Gene Name argonaute RISC catalytic subunit 3
Synonyms eIF2C3, C130014L07Rik, argonaute 3
MMRRC Submission 068796-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8962 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 126225497-126323349 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 126241595 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 68 (F68S)
Ref Sequence ENSEMBL: ENSMUSP00000116204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069097] [ENSMUST00000127831] [ENSMUST00000132123]
AlphaFold Q8CJF9
Predicted Effect probably damaging
Transcript: ENSMUST00000069097
AA Change: F747S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066633
Gene: ENSMUSG00000028842
AA Change: F747S

DomainStartEndE-ValueType
Pfam:ArgoN 20 167 9.4e-26 PFAM
DUF1785 176 228 3.48e-25 SMART
PAZ 236 371 4.18e-4 SMART
Pfam:ArgoL2 376 421 1.3e-14 PFAM
Pfam:ArgoMid 430 512 1.4e-34 PFAM
Piwi 518 819 2.96e-136 SMART
Blast:Piwi 826 852 5e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000127831
AA Change: F84S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118577
Gene: ENSMUSG00000028842
AA Change: F84S

DomainStartEndE-ValueType
Piwi 1 125 9.56e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000132123
AA Change: F68S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116204
Gene: ENSMUSG00000028842
AA Change: F68S

DomainStartEndE-ValueType
Piwi 1 140 1.41e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Argonaute family of proteins which play a role in RNA interference. The encoded protein is highly basic, contains a PAZ domain and a PIWI domain, and may play a role in short-interfering-RNA-mediated gene silencing. This gene is located on chromosome 1 in a tandem cluster of closely related family members including argonaute 4 and eukaryotic translation initiation factor 2C, 1. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(22) : Gene trapped(22)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik T A 9: 46,220,173 (GRCm39) M120L probably benign Het
Abat A G 16: 8,396,166 (GRCm39) T48A probably damaging Het
Abca8a A T 11: 109,969,634 (GRCm39) I314N probably damaging Het
Abr A T 11: 76,352,155 (GRCm39) V108D probably damaging Het
Adamts17 T G 7: 66,725,057 (GRCm39) L162V probably damaging Het
Adamts6 A T 13: 104,433,899 (GRCm39) K109N probably damaging Het
Aifm3 T C 16: 17,324,200 (GRCm39) probably null Het
Ankrd26 T C 6: 118,512,104 (GRCm39) E506G probably benign Het
Apaf1 A G 10: 90,903,066 (GRCm39) L185P probably damaging Het
Atp8b3 G T 10: 80,355,896 (GRCm39) T1272K probably benign Het
Cars2 A G 8: 11,587,304 (GRCm39) V193A probably benign Het
Ccn5 C T 2: 163,667,160 (GRCm39) R54* probably null Het
Ccr8 A T 9: 119,923,613 (GRCm39) I243F possibly damaging Het
Col12a1 A G 9: 79,538,901 (GRCm39) V2465A probably damaging Het
Ctbp1 T C 5: 33,416,616 (GRCm39) N127S probably benign Het
Ddx10 A G 9: 53,149,377 (GRCm39) S117P probably damaging Het
Dgkb T C 12: 38,189,494 (GRCm39) probably null Het
Dnah11 T A 12: 117,916,273 (GRCm39) D3520V probably damaging Het
Dnah11 C T 12: 117,918,630 (GRCm39) D1530N probably damaging Het
Dock5 T C 14: 67,994,640 (GRCm39) T1807A probably benign Het
Drd3 C T 16: 43,641,842 (GRCm39) T386I probably damaging Het
Dsg1b A G 18: 20,542,316 (GRCm39) N941S probably damaging Het
Enpp3 T C 10: 24,696,513 (GRCm39) T141A probably benign Het
Esyt1 A T 10: 128,356,566 (GRCm39) C360S possibly damaging Het
Ethe1 T A 7: 24,305,682 (GRCm39) V143D probably damaging Het
Fam170b A G 14: 32,557,336 (GRCm39) D57G probably benign Het
Fam53c T C 18: 34,901,229 (GRCm39) S49P probably damaging Het
Fbp1 G A 13: 63,023,067 (GRCm39) L77F probably benign Het
Gm17093 A G 14: 44,758,149 (GRCm39) E110G Het
Gm21976 G T 13: 98,423,821 (GRCm39) silent Het
Golgb1 T C 16: 36,733,978 (GRCm39) I1075T probably damaging Het
Grip2 T C 6: 91,754,391 (GRCm39) D628G probably damaging Het
Gtpbp1 G T 15: 79,601,929 (GRCm39) L557F probably benign Het
Ighv12-3 A T 12: 114,330,204 (GRCm39) F97Y probably benign Het
Itga8 T C 2: 12,196,045 (GRCm39) H635R possibly damaging Het
Itgb7 A G 15: 102,127,037 (GRCm39) L466S probably damaging Het
Klc2 T C 19: 5,161,864 (GRCm39) D277G probably benign Het
Ktn1 A G 14: 47,901,248 (GRCm39) E2G probably damaging Het
Lcmt1 T A 7: 123,000,669 (GRCm39) Y68N probably damaging Het
Marchf10 G T 11: 105,280,815 (GRCm39) S490* probably null Het
Mterf1b A T 5: 4,246,437 (GRCm39) Y26F probably benign Het
Myo18b T A 5: 113,006,346 (GRCm39) I855F probably benign Het
Nek4 G A 14: 30,675,915 (GRCm39) M83I probably damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nos1 T C 5: 118,017,405 (GRCm39) V256A probably benign Het
Nr1h2 T C 7: 44,201,463 (GRCm39) T50A probably benign Het
Or14c42-ps1 T A 7: 86,211,317 (GRCm39) *126K probably null Het
Or4n4 A C 14: 50,518,816 (GRCm39) M298R possibly damaging Het
Ovol2 G C 2: 144,147,834 (GRCm39) R172G probably damaging Het
Parp14 A G 16: 35,677,187 (GRCm39) I927T probably damaging Het
Pcdhga7 T A 18: 37,848,879 (GRCm39) H295Q probably benign Het
Pkhd1l1 C T 15: 44,400,291 (GRCm39) T2145I probably damaging Het
Plekhs1 C T 19: 56,461,680 (GRCm39) T139I possibly damaging Het
Rab11fip3 T A 17: 26,231,007 (GRCm39) D746V probably damaging Het
Rnf214 A C 9: 45,809,728 (GRCm39) probably null Het
Rtn4ip1 A T 10: 43,822,415 (GRCm39) probably null Het
S1pr1 T C 3: 115,505,569 (GRCm39) R342G Het
Serpina1f T C 12: 103,656,131 (GRCm39) S366G probably benign Het
Sestd1 A T 2: 77,042,708 (GRCm39) M282K probably benign Het
Siglecf T G 7: 43,001,140 (GRCm39) V36G probably damaging Het
Slc1a1 T C 19: 28,886,869 (GRCm39) V410A probably damaging Het
Slc38a4 C A 15: 96,917,684 (GRCm39) D14Y probably benign Het
Slk C T 19: 47,610,748 (GRCm39) T806M probably damaging Het
Slurp2 C A 15: 74,615,249 (GRCm39) V48F possibly damaging Het
Socs1 A G 16: 10,602,642 (GRCm39) S32P possibly damaging Het
Son T C 16: 91,455,057 (GRCm39) V1268A possibly damaging Het
Sp7 C A 15: 102,274,880 (GRCm39) probably benign Het
Speer4a2 T G 5: 26,290,745 (GRCm39) E142A probably benign Het
Taar7b T G 10: 23,876,359 (GRCm39) S175A probably benign Het
Tet2 T C 3: 133,193,804 (GRCm39) N210S probably benign Het
Tkfc T C 19: 10,570,700 (GRCm39) D492G probably damaging Het
Tmc7 G A 7: 118,160,228 (GRCm39) P203L probably benign Het
Trmt9b A G 8: 36,972,729 (GRCm39) K60E probably damaging Het
Tshz2 C A 2: 169,726,524 (GRCm39) F373L probably damaging Het
Ttc29 T A 8: 79,042,336 (GRCm39) L307Q probably damaging Het
Tubd1 G A 11: 86,439,659 (GRCm39) M1I probably null Het
Vmn1r62 T A 7: 5,678,601 (GRCm39) M94K probably damaging Het
Vmn2r125 T C 4: 156,703,186 (GRCm39) I188T possibly damaging Het
Vmn2r5 T C 3: 64,398,564 (GRCm39) D805G probably damaging Het
Vmn2r6 A T 3: 64,463,576 (GRCm39) D419E probably damaging Het
Vps39 A T 2: 120,174,687 (GRCm39) Y98* probably null Het
Zdbf2 G A 1: 63,347,162 (GRCm39) G1847D probably benign Het
Zdhhc6 T C 19: 55,287,239 (GRCm39) E407G probably benign Het
Zfp407 A G 18: 84,577,057 (GRCm39) I1352T probably damaging Het
Zfp607a A G 7: 27,578,786 (GRCm39) K619E possibly damaging Het
Zfp811 A T 17: 33,017,622 (GRCm39) N139K probably benign Het
Other mutations in Ago3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ago3 APN 4 126,265,334 (GRCm39) missense probably damaging 1.00
IGL01826:Ago3 APN 4 126,297,075 (GRCm39) missense probably damaging 1.00
IGL02285:Ago3 APN 4 126,244,670 (GRCm39) missense possibly damaging 0.88
IGL02869:Ago3 APN 4 126,261,580 (GRCm39) splice site probably benign
IGL03068:Ago3 APN 4 126,311,171 (GRCm39) missense probably damaging 0.99
D4043:Ago3 UTSW 4 126,244,796 (GRCm39) missense probably damaging 1.00
R0506:Ago3 UTSW 4 126,311,045 (GRCm39) missense possibly damaging 0.79
R0545:Ago3 UTSW 4 126,311,025 (GRCm39) missense probably damaging 1.00
R0764:Ago3 UTSW 4 126,248,885 (GRCm39) missense possibly damaging 0.82
R1445:Ago3 UTSW 4 126,265,580 (GRCm39) missense probably benign
R1706:Ago3 UTSW 4 126,264,085 (GRCm39) missense probably damaging 1.00
R1909:Ago3 UTSW 4 126,240,530 (GRCm39) missense probably damaging 1.00
R1944:Ago3 UTSW 4 126,247,520 (GRCm39) missense probably damaging 1.00
R1974:Ago3 UTSW 4 126,240,544 (GRCm39) missense probably damaging 1.00
R2239:Ago3 UTSW 4 126,262,315 (GRCm39) missense probably damaging 1.00
R2380:Ago3 UTSW 4 126,262,315 (GRCm39) missense probably damaging 1.00
R2424:Ago3 UTSW 4 126,298,040 (GRCm39) missense probably damaging 1.00
R2571:Ago3 UTSW 4 126,257,604 (GRCm39) missense probably damaging 1.00
R3121:Ago3 UTSW 4 126,311,165 (GRCm39) missense probably benign
R3122:Ago3 UTSW 4 126,311,165 (GRCm39) missense probably benign
R4022:Ago3 UTSW 4 126,262,386 (GRCm39) missense probably benign 0.31
R4079:Ago3 UTSW 4 126,247,473 (GRCm39) critical splice donor site probably null
R4272:Ago3 UTSW 4 126,248,884 (GRCm39) missense possibly damaging 0.95
R4533:Ago3 UTSW 4 126,239,356 (GRCm39) missense probably damaging 1.00
R4575:Ago3 UTSW 4 126,240,475 (GRCm39) missense probably benign 0.06
R4656:Ago3 UTSW 4 126,257,545 (GRCm39) nonsense probably null
R4782:Ago3 UTSW 4 126,241,665 (GRCm39) splice site probably null
R4783:Ago3 UTSW 4 126,262,296 (GRCm39) missense probably benign 0.31
R4784:Ago3 UTSW 4 126,262,296 (GRCm39) missense probably benign 0.31
R4785:Ago3 UTSW 4 126,262,296 (GRCm39) missense probably benign 0.31
R4799:Ago3 UTSW 4 126,241,665 (GRCm39) splice site probably null
R5013:Ago3 UTSW 4 126,262,391 (GRCm39) missense probably benign 0.18
R5180:Ago3 UTSW 4 126,261,544 (GRCm39) missense probably benign 0.01
R5692:Ago3 UTSW 4 126,248,862 (GRCm39) splice site probably null
R5801:Ago3 UTSW 4 126,265,561 (GRCm39) missense possibly damaging 0.53
R5955:Ago3 UTSW 4 126,248,843 (GRCm39) missense probably damaging 1.00
R6730:Ago3 UTSW 4 126,265,338 (GRCm39) missense probably null 0.04
R7077:Ago3 UTSW 4 126,265,325 (GRCm39) missense probably null 0.01
R7123:Ago3 UTSW 4 126,248,798 (GRCm39) critical splice donor site probably null
R7125:Ago3 UTSW 4 126,264,145 (GRCm39) missense probably null 0.89
R7354:Ago3 UTSW 4 126,311,099 (GRCm39) missense possibly damaging 0.72
R7472:Ago3 UTSW 4 126,239,310 (GRCm39) missense probably damaging 1.00
R7522:Ago3 UTSW 4 126,257,600 (GRCm39) missense probably benign 0.00
R7863:Ago3 UTSW 4 126,243,990 (GRCm39) missense possibly damaging 0.53
R8163:Ago3 UTSW 4 126,262,377 (GRCm39) missense probably benign 0.10
R8225:Ago3 UTSW 4 126,247,532 (GRCm39) missense probably damaging 1.00
R8266:Ago3 UTSW 4 126,270,721 (GRCm39) nonsense probably null
R8269:Ago3 UTSW 4 126,270,721 (GRCm39) nonsense probably null
R8343:Ago3 UTSW 4 126,270,721 (GRCm39) nonsense probably null
R8344:Ago3 UTSW 4 126,270,721 (GRCm39) nonsense probably null
R8345:Ago3 UTSW 4 126,270,721 (GRCm39) nonsense probably null
R8547:Ago3 UTSW 4 126,264,109 (GRCm39) missense probably null 0.82
R8948:Ago3 UTSW 4 126,244,115 (GRCm39) critical splice acceptor site probably null
R8989:Ago3 UTSW 4 126,298,191 (GRCm39) missense probably damaging 1.00
R9110:Ago3 UTSW 4 126,248,829 (GRCm39) missense probably damaging 1.00
R9356:Ago3 UTSW 4 126,264,144 (GRCm39) missense probably damaging 1.00
T0722:Ago3 UTSW 4 126,298,098 (GRCm39) missense probably benign
T0722:Ago3 UTSW 4 126,298,089 (GRCm39) missense probably benign 0.21
T0722:Ago3 UTSW 4 126,298,056 (GRCm39) missense probably benign
T0722:Ago3 UTSW 4 126,298,103 (GRCm39) missense probably benign 0.00
T0975:Ago3 UTSW 4 126,298,103 (GRCm39) missense probably benign 0.00
T0975:Ago3 UTSW 4 126,298,098 (GRCm39) missense probably benign
T0975:Ago3 UTSW 4 126,298,056 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCTCTTAAAGCAAGGAAAAGG -3'
(R):5'- GGAGCCAGGTATTCTGTTTCCTC -3'

Sequencing Primer
(F):5'- CAAGGAAAAGGAAGAAATTCACTTAC -3'
(R):5'- GATCTCTGTAAGTTCAAGGCTAGCC -3'
Posted On 2021-08-31