Incidental Mutation 'R8962:Grip2'
ID 682385
Institutional Source Beutler Lab
Gene Symbol Grip2
Ensembl Gene ENSMUSG00000030098
Gene Name glutamate receptor interacting protein 2
Synonyms
MMRRC Submission 068796-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8962 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 91738490-91804231 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 91754391 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 628 (D628G)
Ref Sequence ENSEMBL: ENSMUSP00000124717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159684] [ENSMUST00000162293] [ENSMUST00000162300]
AlphaFold G3XA20
Predicted Effect possibly damaging
Transcript: ENSMUST00000159684
AA Change: D639G

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125047
Gene: ENSMUSG00000030098
AA Change: D639G

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
PDZ 62 136 1.12e-12 SMART
PDZ 161 239 3.8e-15 SMART
PDZ 262 337 7.9e-13 SMART
low complexity region 385 390 N/A INTRINSIC
PDZ 426 506 2.18e-15 SMART
PDZ 527 602 3.86e-16 SMART
PDZ 625 699 1.38e-17 SMART
low complexity region 778 793 N/A INTRINSIC
low complexity region 867 878 N/A INTRINSIC
PDZ 910 982 2.95e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162293
AA Change: D628G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124717
Gene: ENSMUSG00000030098
AA Change: D628G

DomainStartEndE-ValueType
PDZ 10 84 1.12e-12 SMART
PDZ 109 187 3.8e-15 SMART
PDZ 210 285 7.9e-13 SMART
low complexity region 336 348 N/A INTRINSIC
low complexity region 374 379 N/A INTRINSIC
PDZ 415 495 2.18e-15 SMART
PDZ 516 591 3.86e-16 SMART
PDZ 614 688 1.38e-17 SMART
low complexity region 767 782 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162300
AA Change: D680G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124709
Gene: ENSMUSG00000030098
AA Change: D680G

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
PDZ 62 136 1.12e-12 SMART
PDZ 161 239 3.8e-15 SMART
PDZ 262 337 7.9e-13 SMART
low complexity region 388 400 N/A INTRINSIC
low complexity region 426 431 N/A INTRINSIC
PDZ 467 547 2.18e-15 SMART
PDZ 568 643 3.86e-16 SMART
PDZ 666 740 1.38e-17 SMART
low complexity region 819 834 N/A INTRINSIC
low complexity region 908 919 N/A INTRINSIC
PDZ 951 1023 2.95e-12 SMART
Meta Mutation Damage Score 0.3063 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 99% (86/87)
MGI Phenotype PHENOTYPE: Homozygous null mice are born in numbers expected by the Mendelian ratio and show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik T A 9: 46,220,173 (GRCm39) M120L probably benign Het
Abat A G 16: 8,396,166 (GRCm39) T48A probably damaging Het
Abca8a A T 11: 109,969,634 (GRCm39) I314N probably damaging Het
Abr A T 11: 76,352,155 (GRCm39) V108D probably damaging Het
Adamts17 T G 7: 66,725,057 (GRCm39) L162V probably damaging Het
Adamts6 A T 13: 104,433,899 (GRCm39) K109N probably damaging Het
Ago3 A G 4: 126,241,595 (GRCm39) F68S probably damaging Het
Aifm3 T C 16: 17,324,200 (GRCm39) probably null Het
Ankrd26 T C 6: 118,512,104 (GRCm39) E506G probably benign Het
Apaf1 A G 10: 90,903,066 (GRCm39) L185P probably damaging Het
Atp8b3 G T 10: 80,355,896 (GRCm39) T1272K probably benign Het
Cars2 A G 8: 11,587,304 (GRCm39) V193A probably benign Het
Ccn5 C T 2: 163,667,160 (GRCm39) R54* probably null Het
Ccr8 A T 9: 119,923,613 (GRCm39) I243F possibly damaging Het
Col12a1 A G 9: 79,538,901 (GRCm39) V2465A probably damaging Het
Ctbp1 T C 5: 33,416,616 (GRCm39) N127S probably benign Het
Ddx10 A G 9: 53,149,377 (GRCm39) S117P probably damaging Het
Dgkb T C 12: 38,189,494 (GRCm39) probably null Het
Dnah11 T A 12: 117,916,273 (GRCm39) D3520V probably damaging Het
Dnah11 C T 12: 117,918,630 (GRCm39) D1530N probably damaging Het
Dock5 T C 14: 67,994,640 (GRCm39) T1807A probably benign Het
Drd3 C T 16: 43,641,842 (GRCm39) T386I probably damaging Het
Dsg1b A G 18: 20,542,316 (GRCm39) N941S probably damaging Het
Enpp3 T C 10: 24,696,513 (GRCm39) T141A probably benign Het
Esyt1 A T 10: 128,356,566 (GRCm39) C360S possibly damaging Het
Ethe1 T A 7: 24,305,682 (GRCm39) V143D probably damaging Het
Fam170b A G 14: 32,557,336 (GRCm39) D57G probably benign Het
Fam53c T C 18: 34,901,229 (GRCm39) S49P probably damaging Het
Fbp1 G A 13: 63,023,067 (GRCm39) L77F probably benign Het
Gm17093 A G 14: 44,758,149 (GRCm39) E110G Het
Gm21976 G T 13: 98,423,821 (GRCm39) silent Het
Golgb1 T C 16: 36,733,978 (GRCm39) I1075T probably damaging Het
Gtpbp1 G T 15: 79,601,929 (GRCm39) L557F probably benign Het
Ighv12-3 A T 12: 114,330,204 (GRCm39) F97Y probably benign Het
Itga8 T C 2: 12,196,045 (GRCm39) H635R possibly damaging Het
Itgb7 A G 15: 102,127,037 (GRCm39) L466S probably damaging Het
Klc2 T C 19: 5,161,864 (GRCm39) D277G probably benign Het
Ktn1 A G 14: 47,901,248 (GRCm39) E2G probably damaging Het
Lcmt1 T A 7: 123,000,669 (GRCm39) Y68N probably damaging Het
Marchf10 G T 11: 105,280,815 (GRCm39) S490* probably null Het
Mterf1b A T 5: 4,246,437 (GRCm39) Y26F probably benign Het
Myo18b T A 5: 113,006,346 (GRCm39) I855F probably benign Het
Nek4 G A 14: 30,675,915 (GRCm39) M83I probably damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nos1 T C 5: 118,017,405 (GRCm39) V256A probably benign Het
Nr1h2 T C 7: 44,201,463 (GRCm39) T50A probably benign Het
Or14c42-ps1 T A 7: 86,211,317 (GRCm39) *126K probably null Het
Or4n4 A C 14: 50,518,816 (GRCm39) M298R possibly damaging Het
Ovol2 G C 2: 144,147,834 (GRCm39) R172G probably damaging Het
Parp14 A G 16: 35,677,187 (GRCm39) I927T probably damaging Het
Pcdhga7 T A 18: 37,848,879 (GRCm39) H295Q probably benign Het
Pkhd1l1 C T 15: 44,400,291 (GRCm39) T2145I probably damaging Het
Plekhs1 C T 19: 56,461,680 (GRCm39) T139I possibly damaging Het
Rab11fip3 T A 17: 26,231,007 (GRCm39) D746V probably damaging Het
Rnf214 A C 9: 45,809,728 (GRCm39) probably null Het
Rtn4ip1 A T 10: 43,822,415 (GRCm39) probably null Het
S1pr1 T C 3: 115,505,569 (GRCm39) R342G Het
Serpina1f T C 12: 103,656,131 (GRCm39) S366G probably benign Het
Sestd1 A T 2: 77,042,708 (GRCm39) M282K probably benign Het
Siglecf T G 7: 43,001,140 (GRCm39) V36G probably damaging Het
Slc1a1 T C 19: 28,886,869 (GRCm39) V410A probably damaging Het
Slc38a4 C A 15: 96,917,684 (GRCm39) D14Y probably benign Het
Slk C T 19: 47,610,748 (GRCm39) T806M probably damaging Het
Slurp2 C A 15: 74,615,249 (GRCm39) V48F possibly damaging Het
Socs1 A G 16: 10,602,642 (GRCm39) S32P possibly damaging Het
Son T C 16: 91,455,057 (GRCm39) V1268A possibly damaging Het
Sp7 C A 15: 102,274,880 (GRCm39) probably benign Het
Speer4a2 T G 5: 26,290,745 (GRCm39) E142A probably benign Het
Taar7b T G 10: 23,876,359 (GRCm39) S175A probably benign Het
Tet2 T C 3: 133,193,804 (GRCm39) N210S probably benign Het
Tkfc T C 19: 10,570,700 (GRCm39) D492G probably damaging Het
Tmc7 G A 7: 118,160,228 (GRCm39) P203L probably benign Het
Trmt9b A G 8: 36,972,729 (GRCm39) K60E probably damaging Het
Tshz2 C A 2: 169,726,524 (GRCm39) F373L probably damaging Het
Ttc29 T A 8: 79,042,336 (GRCm39) L307Q probably damaging Het
Tubd1 G A 11: 86,439,659 (GRCm39) M1I probably null Het
Vmn1r62 T A 7: 5,678,601 (GRCm39) M94K probably damaging Het
Vmn2r125 T C 4: 156,703,186 (GRCm39) I188T possibly damaging Het
Vmn2r5 T C 3: 64,398,564 (GRCm39) D805G probably damaging Het
Vmn2r6 A T 3: 64,463,576 (GRCm39) D419E probably damaging Het
Vps39 A T 2: 120,174,687 (GRCm39) Y98* probably null Het
Zdbf2 G A 1: 63,347,162 (GRCm39) G1847D probably benign Het
Zdhhc6 T C 19: 55,287,239 (GRCm39) E407G probably benign Het
Zfp407 A G 18: 84,577,057 (GRCm39) I1352T probably damaging Het
Zfp607a A G 7: 27,578,786 (GRCm39) K619E possibly damaging Het
Zfp811 A T 17: 33,017,622 (GRCm39) N139K probably benign Het
Other mutations in Grip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Grip2 APN 6 91,759,878 (GRCm39) missense probably benign 0.00
IGL01748:Grip2 APN 6 91,741,724 (GRCm39) missense probably damaging 1.00
IGL01838:Grip2 APN 6 91,741,744 (GRCm39) missense possibly damaging 0.92
IGL02392:Grip2 APN 6 91,764,276 (GRCm39) missense probably damaging 1.00
IGL02620:Grip2 APN 6 91,755,587 (GRCm39) missense possibly damaging 0.93
IGL02862:Grip2 APN 6 91,765,085 (GRCm39) missense probably damaging 0.98
IGL03027:Grip2 APN 6 91,755,852 (GRCm39) missense probably benign 0.02
IGL03180:Grip2 APN 6 91,762,742 (GRCm39) splice site probably benign
R0265:Grip2 UTSW 6 91,750,773 (GRCm39) critical splice donor site probably null
R0448:Grip2 UTSW 6 91,756,194 (GRCm39) missense probably damaging 1.00
R0597:Grip2 UTSW 6 91,773,178 (GRCm39) intron probably benign
R1405:Grip2 UTSW 6 91,765,133 (GRCm39) splice site probably null
R1405:Grip2 UTSW 6 91,765,133 (GRCm39) splice site probably null
R1466:Grip2 UTSW 6 91,765,424 (GRCm39) missense probably damaging 0.98
R1466:Grip2 UTSW 6 91,765,424 (GRCm39) missense probably damaging 0.98
R1664:Grip2 UTSW 6 91,742,233 (GRCm39) missense probably damaging 1.00
R1703:Grip2 UTSW 6 91,754,379 (GRCm39) missense probably damaging 1.00
R1793:Grip2 UTSW 6 91,760,623 (GRCm39) missense probably benign 0.03
R1951:Grip2 UTSW 6 91,760,829 (GRCm39) missense probably damaging 1.00
R2001:Grip2 UTSW 6 91,756,831 (GRCm39) missense probably benign 0.00
R4730:Grip2 UTSW 6 91,762,693 (GRCm39) makesense probably null
R4754:Grip2 UTSW 6 91,756,173 (GRCm39) missense probably damaging 0.97
R4754:Grip2 UTSW 6 91,756,163 (GRCm39) missense probably damaging 1.00
R4773:Grip2 UTSW 6 91,759,413 (GRCm39) missense possibly damaging 0.80
R5135:Grip2 UTSW 6 91,750,897 (GRCm39) missense possibly damaging 0.89
R5213:Grip2 UTSW 6 91,756,812 (GRCm39) missense probably benign 0.04
R5972:Grip2 UTSW 6 91,784,262 (GRCm39) missense probably benign 0.01
R6176:Grip2 UTSW 6 91,756,832 (GRCm39) missense probably benign 0.00
R6188:Grip2 UTSW 6 91,740,514 (GRCm39) missense probably damaging 1.00
R6289:Grip2 UTSW 6 91,755,852 (GRCm39) missense probably benign 0.02
R6345:Grip2 UTSW 6 91,742,369 (GRCm39) missense possibly damaging 0.91
R6348:Grip2 UTSW 6 91,757,419 (GRCm39) missense probably damaging 0.99
R6394:Grip2 UTSW 6 91,764,182 (GRCm39) missense probably damaging 1.00
R6658:Grip2 UTSW 6 91,763,472 (GRCm39) missense probably damaging 1.00
R7065:Grip2 UTSW 6 91,760,550 (GRCm39) critical splice donor site probably null
R7074:Grip2 UTSW 6 91,761,689 (GRCm39) missense probably benign 0.24
R7308:Grip2 UTSW 6 91,755,669 (GRCm39) missense possibly damaging 0.74
R7607:Grip2 UTSW 6 91,765,393 (GRCm39) missense probably benign
R7617:Grip2 UTSW 6 91,742,031 (GRCm39) splice site probably null
R7970:Grip2 UTSW 6 91,763,513 (GRCm39) missense probably benign 0.07
R8221:Grip2 UTSW 6 91,762,665 (GRCm39) missense possibly damaging 0.90
R8549:Grip2 UTSW 6 91,750,769 (GRCm39) splice site probably null
R8838:Grip2 UTSW 6 91,762,721 (GRCm39) utr 3 prime probably benign
R9430:Grip2 UTSW 6 91,784,265 (GRCm39) missense probably benign 0.05
R9699:Grip2 UTSW 6 91,742,318 (GRCm39) missense probably benign
R9732:Grip2 UTSW 6 91,761,686 (GRCm39) missense probably damaging 0.99
RF003:Grip2 UTSW 6 91,760,574 (GRCm39) missense probably benign 0.02
Z1176:Grip2 UTSW 6 91,740,491 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TGGGCTGGACCAAAATTCATTC -3'
(R):5'- TGAGGGTTCGATGAGGTCAC -3'

Sequencing Primer
(F):5'- AATTCATTCATGTTAAGGATGGGGAG -3'
(R):5'- CACTGGTGTTTGAAGAGTGC -3'
Posted On 2021-08-31