Mutagenetix > Incidental Mutation

Incidental Mutation 'R8962:Ethe1'

682388

Institutional Source

Beutler Lab

Gene Symbol

Ethe1

Ensembl Gene

ENSMUSG00000064254

Gene Name

ethylmalonic encephalopathy 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.715) question?

Stock #

R8962 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

24587543-24608925 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 24606257 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 143 (V143D)

Ref Sequence

ENSEMBL: ENSMUSP00000076433 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077191] [ENSMUST00000206422]

AlphaFold

Q9DCM0

Predicted Effect

probably damaging
Transcript: ENSMUST00000077191
AA Change: V143D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000076433
Gene: ENSMUSG00000064254
AA Change: V143D

Domain	Start	End	E-Value	Type
Lactamase_B	34	195	1.05e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000206422

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.4%

Validation Efficiency

99% (86/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the metallo beta-lactamase family of iron-containing proteins involved in the mitochondrial sulfide oxidation pathway. The encoded protein catalyzes the oxidation of a persulfide substrate to sulfite. Certain mutations in this gene cause ethylmalonic encephalopathy, an infantile metabolic disorder affecting the brain, gastrointestinal tract and peripheral vessels. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a null mutation display premature death with elevated levels of hydrogen sulfide and thiosulfates. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931429L15Rik	T	A	9: 46,308,875	M120L	probably benign	Het
6430573F11Rik	A	G	8: 36,505,575	K60E	probably damaging	Het
Abat	A	G	16: 8,578,302	T48A	probably damaging	Het
Abca8a	A	T	11: 110,078,808	I314N	probably damaging	Het
Abr	A	T	11: 76,461,329	V108D	probably damaging	Het
Adamts17	T	G	7: 67,075,309	L162V	probably damaging	Het
Adamts6	A	T	13: 104,297,391	K109N	probably damaging	Het
Ago3	A	G	4: 126,347,802	F68S	probably damaging	Het
Aifm3	T	C	16: 17,506,336		probably null	Het
Ankrd26	T	C	6: 118,535,143	E506G	probably benign	Het
Apaf1	A	G	10: 91,067,204	L185P	probably damaging	Het
Atp8b3	G	T	10: 80,520,062	T1272K	probably benign	Het
Cars2	A	G	8: 11,537,304	V193A	probably benign	Het
Ccr8	A	T	9: 120,094,547	I243F	possibly damaging	Het
Col12a1	A	G	9: 79,631,619	V2465A	probably damaging	Het
Ctbp1	T	C	5: 33,259,272	N127S	probably benign	Het
Ddx10	A	G	9: 53,238,077	S117P	probably damaging	Het
Dgkb	T	C	12: 38,139,495		probably null	Het
Dnah11	T	A	12: 117,952,538	D3520V	probably damaging	Het
Dnah11	C	T	12: 117,954,895	D1530N	probably damaging	Het
Dock5	T	C	14: 67,757,191	T1807A	probably benign	Het
Drd3	C	T	16: 43,821,479	T386I	probably damaging	Het
Dsg1b	A	G	18: 20,409,259	N941S	probably damaging	Het
Enpp3	T	C	10: 24,820,615	T141A	probably benign	Het
Esyt1	A	T	10: 128,520,697	C360S	possibly damaging	Het
Fam170b	A	G	14: 32,835,379	D57G	probably benign	Het
Fam53c	T	C	18: 34,768,176	S49P	probably damaging	Het
Fbp1	G	A	13: 62,875,253	L77F	probably benign	Het
Gm10471	T	G	5: 26,085,747	E142A	probably benign	Het
Gm17093	A	G	14: 44,520,692	E110G		Het
Gm21976	G	T	13: 98,287,313		silent	Het
Golgb1	T	C	16: 36,913,616	I1075T	probably damaging	Het
Grip2	T	C	6: 91,777,410	D628G	probably damaging	Het
Gtpbp1	G	T	15: 79,717,728	L557F	probably benign	Het
Ighv12-3	A	T	12: 114,366,584	F97Y	probably benign	Het
Itga8	T	C	2: 12,191,234	H635R	possibly damaging	Het
Itgb7	A	G	15: 102,218,602	L466S	probably damaging	Het
Klc2	T	C	19: 5,111,836	D277G	probably benign	Het
Ktn1	A	G	14: 47,663,791	E2G	probably damaging	Het
Lcmt1	T	A	7: 123,401,446	Y68N	probably damaging	Het
March10	G	T	11: 105,389,989	S490*	probably null	Het
Mterf1b	A	T	5: 4,196,437	Y26F	probably benign	Het
Myo18b	T	A	5: 112,858,480	I855F	probably benign	Het
Nek4	G	A	14: 30,953,958	M83I	probably damaging	Het
Nicn1	C	T	9: 108,294,509	R163C	possibly damaging	Het
Nos1	T	C	5: 117,879,340	V256A	probably benign	Het
Nr1h2	T	C	7: 44,552,039	T50A	probably benign	Het
Olfr296-ps1	T	A	7: 86,562,109	*126K	probably null	Het
Olfr732	A	C	14: 50,281,359	M298R	possibly damaging	Het
Ovol2	G	C	2: 144,305,914	R172G	probably damaging	Het
Parp14	A	G	16: 35,856,817	I927T	probably damaging	Het
Pcdhga7	T	A	18: 37,715,826	H295Q	probably benign	Het
Pkhd1l1	C	T	15: 44,536,895	T2145I	probably damaging	Het
Plekhs1	C	T	19: 56,473,248	T139I	possibly damaging	Het
Rab11fip3	T	A	17: 26,012,033	D746V	probably damaging	Het
Rnf214	A	C	9: 45,898,430		probably null	Het
Rtn4ip1	A	T	10: 43,946,419		probably null	Het
S1pr1	T	C	3: 115,711,920	R342G		Het
Serpina1f	T	C	12: 103,689,872	S366G	probably benign	Het
Sestd1	A	T	2: 77,212,364	M282K	probably benign	Het
Siglecf	T	G	7: 43,351,716	V36G	probably damaging	Het
Slc1a1	T	C	19: 28,909,469	V410A	probably damaging	Het
Slc38a4	C	A	15: 97,019,803	D14Y	probably benign	Het
Slk	C	T	19: 47,622,309	T806M	probably damaging	Het
Slurp2	C	A	15: 74,743,400	V48F	possibly damaging	Het
Socs1	A	G	16: 10,784,778	S32P	possibly damaging	Het
Son	T	C	16: 91,658,169	V1268A	possibly damaging	Het
Sp7	C	A	15: 102,366,445		probably benign	Het
Taar7b	T	G	10: 24,000,461	S175A	probably benign	Het
Tet2	T	C	3: 133,488,043	N210S	probably benign	Het
Tkfc	T	C	19: 10,593,336	D492G	probably damaging	Het
Tmc7	G	A	7: 118,561,005	P203L	probably benign	Het
Tshz2	C	A	2: 169,884,604	F373L	probably damaging	Het
Ttc29	T	A	8: 78,315,707	L307Q	probably damaging	Het
Tubd1	G	A	11: 86,548,833	M1I	probably null	Het
Vmn1r62	T	A	7: 5,675,602	M94K	probably damaging	Het
Vmn2r125	T	C	4: 156,350,891	I188T	possibly damaging	Het
Vmn2r5	T	C	3: 64,491,143	D805G	probably damaging	Het
Vmn2r6	A	T	3: 64,556,155	D419E	probably damaging	Het
Vps39	A	T	2: 120,344,206	Y98*	probably null	Het
Wisp2	C	T	2: 163,825,240	R54*	probably null	Het
Zdbf2	G	A	1: 63,308,003	G1847D	probably benign	Het
Zdhhc6	T	C	19: 55,298,807	E407G	probably benign	Het
Zfp407	A	G	18: 84,558,932	I1352T	probably damaging	Het
Zfp607a	A	G	7: 27,879,361	K619E	possibly damaging	Het
Zfp811	A	T	17: 32,798,648	N139K	probably benign	Het

Other mutations in Ethe1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01779:Ethe1	APN	7	24595009	missense	probably damaging	1.00
nutriceutical	UTSW	7	24595071	missense	probably damaging	1.00
R0565:Ethe1	UTSW	7	24607889	missense	probably benign	0.00
R1734:Ethe1	UTSW	7	24608384	missense	probably benign	0.00
R1757:Ethe1	UTSW	7	24608474	unclassified	probably benign
R1774:Ethe1	UTSW	7	24593946	missense	probably benign	0.01
R4662:Ethe1	UTSW	7	24593980	missense	probably benign	0.00
R4676:Ethe1	UTSW	7	24607894	missense	probably damaging	1.00
R7286:Ethe1	UTSW	7	24607952	missense	probably damaging	1.00
R7424:Ethe1	UTSW	7	24606251	missense	probably damaging	1.00
R8808:Ethe1	UTSW	7	24595071	missense	probably damaging	1.00
R8817:Ethe1	UTSW	7	24606302	missense	probably damaging	1.00
R9114:Ethe1	UTSW	7	24606218	missense	probably benign	0.01
R9570:Ethe1	UTSW	7	24593811	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- TAACTTTAAGCAAAACGGTCCCT -3'
(R):5'- GAACAACCTTCATGTACTCTTGC -3'

Sequencing Primer
(F):5'- GCAAAACGGTCCCTGTATTC -3'
(R):5'- TGGAACTCACTCTGTAGACCAGG -3'

Posted On

2021-08-31