Incidental Mutation 'R0735:Adam10'
ID68239
Institutional Source Beutler Lab
Gene Symbol Adam10
Ensembl Gene ENSMUSG00000054693
Gene Namea disintegrin and metallopeptidase domain 10
Synonymskuzbanian, 1700031C13Rik, kuz
MMRRC Submission 038916-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0735 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location70678997-70780229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70748251 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 334 (V334I)
Ref Sequence ENSEMBL: ENSMUSP00000117162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067880] [ENSMUST00000140205] [ENSMUST00000144537]
Predicted Effect probably benign
Transcript: ENSMUST00000067880
AA Change: V334I

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000063839
Gene: ENSMUSG00000054693
AA Change: V334I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Pep_M12B_propep 27 156 7.5e-15 PFAM
Pfam:Reprolysin_5 219 434 1e-33 PFAM
Pfam:Reprolysin_4 219 453 2.1e-29 PFAM
Pfam:Reprolysin 221 457 6.1e-8 PFAM
Pfam:Reprolysin_2 240 447 6.5e-39 PFAM
Pfam:Reprolysin_3 244 395 4.6e-27 PFAM
DISIN 467 551 5.99e-23 SMART
transmembrane domain 675 697 N/A INTRINSIC
low complexity region 709 739 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000140205
AA Change: V334I

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117162
Gene: ENSMUSG00000054693
AA Change: V334I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 156 5.8e-18 PFAM
Pfam:Reprolysin_5 219 434 2.6e-34 PFAM
Pfam:Reprolysin_4 219 453 4e-30 PFAM
Pfam:Reprolysin 221 457 4.4e-10 PFAM
Pfam:Reprolysin_2 240 447 5.1e-36 PFAM
Pfam:Reprolysin_3 244 395 1.7e-24 PFAM
DISIN 467 513 1.48e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144537
SMART Domains Protein: ENSMUSP00000116867
Gene: ENSMUSG00000054693

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Reprolysin_5 76 145 5.8e-9 PFAM
Meta Mutation Damage Score 0.4980 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.7%
  • 20x: 91.8%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature enzyme that is involved in the proteolytic release of membrane-bound proteins in a process called ectodomain shedding. Mice lacking the encoded protein die in utero with multiple defects of the developing central nervous system, somites, and cardiovascular system. [provided by RefSeq, May 2016]
PHENOTYPE: Targeted inactivation of this gene leads to embryonic lethality at E9.5. Embryos homozygous for a knock-out allele display decreased size and multiple abnormalities related to Notch signaling, including defects of the developing central nervous system, somites, and cardiovascular system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,717,638 I1552K possibly damaging Het
Actr8 T A 14: 29,989,712 M405K probably benign Het
Adgra2 G T 8: 27,117,318 G686C probably damaging Het
Akap11 A T 14: 78,510,078 I1623N probably damaging Het
Astn1 A T 1: 158,472,389 T100S possibly damaging Het
B3galt1 A C 2: 68,118,579 I213L possibly damaging Het
B4galnt4 A G 7: 141,064,323 K101E probably benign Het
Camsap2 A G 1: 136,292,888 S324P probably damaging Het
Chrnb4 A G 9: 55,043,800 S60P probably damaging Het
Cpne1 A G 2: 156,078,750 probably null Het
Cubn G A 2: 13,491,689 probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cxcl15 T C 5: 90,801,294 M106T probably benign Het
Cyp2c23 A T 19: 44,016,810 M140K probably damaging Het
Dgke A G 11: 89,060,075 F104S probably benign Het
Dhx36 T A 3: 62,472,729 M849L probably benign Het
Dnah7a C T 1: 53,544,511 E1522K possibly damaging Het
Edil3 G T 13: 89,177,178 V219F probably damaging Het
Egln1 A G 8: 124,948,495 V187A possibly damaging Het
Fam193a T C 5: 34,439,378 I455T possibly damaging Het
Fdft1 A T 14: 63,163,420 I88N probably damaging Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Frs2 T A 10: 117,074,582 S292C probably damaging Het
Gm15448 T C 7: 3,821,782 T533A possibly damaging Het
Gpr107 T A 2: 31,171,994 F145I probably benign Het
Gpr153 T A 4: 152,279,373 C83* probably null Het
H2-Q7 T G 17: 35,440,186 probably null Het
Hsp90b1 A T 10: 86,695,748 probably benign Het
Kcnk1 C A 8: 126,025,289 N211K probably damaging Het
Klb T C 5: 65,379,727 V800A probably benign Het
Lat2 T C 5: 134,606,783 Y59C probably damaging Het
Mlkl A T 8: 111,327,801 probably benign Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mtbp T A 15: 55,562,942 C93* probably null Het
Myo7a A G 7: 98,081,180 probably benign Het
Myt1 G A 2: 181,807,387 probably benign Het
Ogfrl1 T C 1: 23,375,754 Q224R possibly damaging Het
Olfr418 A G 1: 173,271,002 T276A probably benign Het
Olfr661 A T 7: 104,688,819 H268L probably damaging Het
Osbpl2 A G 2: 180,150,290 probably benign Het
Plb1 C T 5: 32,284,920 T252M possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbsn T C 6: 92,189,693 T657A probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rps6kb2 C A 19: 4,157,883 S348I probably benign Het
Rsrp1 C T 4: 134,924,257 R111W unknown Het
Ryr3 T C 2: 112,732,982 T2933A probably benign Het
Scara5 A G 14: 65,731,019 D247G possibly damaging Het
Slc7a11 C T 3: 50,424,096 S231N probably benign Het
Sod2 A T 17: 13,010,564 N91Y probably damaging Het
Spesp1 A T 9: 62,272,685 S314T probably benign Het
St3gal1 C A 15: 67,113,687 M39I probably benign Het
Stat6 A T 10: 127,658,241 I646F probably damaging Het
Tdrd1 A T 19: 56,865,978 K1119* probably null Het
Thbs2 A G 17: 14,679,815 I600T probably benign Het
Tor1a A G 2: 30,963,838 V160A probably damaging Het
Trdmt1 T G 2: 13,523,438 D104A probably benign Het
Trim58 T C 11: 58,651,393 V393A probably benign Het
Trip4 C T 9: 65,884,918 probably benign Het
Trip6 T C 5: 137,310,821 E341G probably benign Het
Ttn T A 2: 76,715,195 I32595F probably damaging Het
Ubr4 T A 4: 139,428,028 probably null Het
Ush2a G A 1: 188,864,693 V3877I probably benign Het
Vmn1r29 G T 6: 58,307,732 G146C probably damaging Het
Vmn2r53 A G 7: 12,581,780 V704A probably benign Het
Vmn2r7 C T 3: 64,716,367 M268I probably benign Het
Wnt7b G A 15: 85,537,495 T248M probably damaging Het
Xab2 G A 8: 3,613,649 P394S possibly damaging Het
Zfp663 A G 2: 165,359,075 V13A probably damaging Het
Other mutations in Adam10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Adam10 APN 9 70718746 missense possibly damaging 0.92
IGL00582:Adam10 APN 9 70766895 missense possibly damaging 0.54
IGL02021:Adam10 APN 9 70743909 missense possibly damaging 0.60
IGL02149:Adam10 APN 9 70703431 missense probably damaging 1.00
IGL03310:Adam10 APN 9 70778089 missense probably damaging 1.00
PIT4382001:Adam10 UTSW 9 70766081 missense probably damaging 1.00
R0110:Adam10 UTSW 9 70748248 missense probably damaging 1.00
R0469:Adam10 UTSW 9 70748248 missense probably damaging 1.00
R0510:Adam10 UTSW 9 70748248 missense probably damaging 1.00
R0555:Adam10 UTSW 9 70754234 missense probably damaging 1.00
R0671:Adam10 UTSW 9 70765941 splice site probably benign
R0785:Adam10 UTSW 9 70767888 missense possibly damaging 0.86
R0881:Adam10 UTSW 9 70746237 missense probably damaging 1.00
R1019:Adam10 UTSW 9 70761640 missense probably benign 0.00
R1169:Adam10 UTSW 9 70746292 missense probably damaging 0.97
R1779:Adam10 UTSW 9 70776369 splice site probably benign
R2048:Adam10 UTSW 9 70740075 missense possibly damaging 0.89
R2911:Adam10 UTSW 9 70718723 missense probably damaging 0.99
R3890:Adam10 UTSW 9 70768854 missense probably benign 0.00
R4608:Adam10 UTSW 9 70743891 missense probably damaging 0.99
R4609:Adam10 UTSW 9 70740143 missense probably damaging 1.00
R4689:Adam10 UTSW 9 70765954 missense possibly damaging 0.51
R5135:Adam10 UTSW 9 70766074 missense probably damaging 1.00
R5496:Adam10 UTSW 9 70722739 missense probably damaging 1.00
R5499:Adam10 UTSW 9 70740117 missense probably benign 0.16
R6730:Adam10 UTSW 9 70740176 critical splice donor site probably null
R6825:Adam10 UTSW 9 70761602 missense probably damaging 1.00
R6987:Adam10 UTSW 9 70722696 missense probably benign
R7616:Adam10 UTSW 9 70722711 missense possibly damaging 0.81
R7829:Adam10 UTSW 9 70766927 nonsense probably null
R7908:Adam10 UTSW 9 70761764 missense possibly damaging 0.83
R7989:Adam10 UTSW 9 70761764 missense possibly damaging 0.83
X0020:Adam10 UTSW 9 70740143 missense probably damaging 1.00
X0064:Adam10 UTSW 9 70765952 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGAGCCCATGAGAATGTTGTCCAG -3'
(R):5'- TGACTTTCAGGCCCCATTCCAAGG -3'

Sequencing Primer
(F):5'- ATCATTGACTTCAGTTATTGTTTTGG -3'
(R):5'- tgaacttaccttcccaagcc -3'
Posted On2013-09-03