Incidental Mutation 'R0735:Hsp90b1'
ID68240
Institutional Source Beutler Lab
Gene Symbol Hsp90b1
Ensembl Gene ENSMUSG00000020048
Gene Nameheat shock protein 90, beta (Grp94), member 1
SynonymsERp99, tumor rejection antigen (gp96) 1, Targ2, endoplasmin, Tra-1, Tra1, gp96, GRP94, 90 kDa
MMRRC Submission 038916-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0735 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location86690209-86705509 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 86695748 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020238] [ENSMUST00000129413]
Predicted Effect probably benign
Transcript: ENSMUST00000020238
SMART Domains Protein: ENSMUSP00000020238
Gene: ENSMUSG00000020048

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
HATPase_c 96 255 4.96e-9 SMART
Pfam:HSP90 257 781 2.5e-233 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129178
Predicted Effect probably benign
Transcript: ENSMUST00000129413
SMART Domains Protein: ENSMUSP00000122710
Gene: ENSMUSG00000020048

DomainStartEndE-ValueType
coiled coil region 9 35 N/A INTRINSIC
Pfam:HSP90 39 373 3.8e-170 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152600
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218691
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.7%
  • 20x: 91.8%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of adenosine triphosphate(ATP)-metabolizing molecular chaperones with roles in stabilizing and folding other proteins. The encoded protein is localized to melanosomes and the endoplasmic reticulum. Expression of this protein is associated with a variety of pathogenic states, including tumor formation. There is a microRNA gene located within the 5' exon of this gene. There are pseudogenes for this gene on chromosomes 1 and 15. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before somite formation with failure of primitive streak formation, absence of the chorion and amnion, and failure of mesoderm formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,717,638 I1552K possibly damaging Het
Actr8 T A 14: 29,989,712 M405K probably benign Het
Adam10 G A 9: 70,748,251 V334I possibly damaging Het
Adgra2 G T 8: 27,117,318 G686C probably damaging Het
Akap11 A T 14: 78,510,078 I1623N probably damaging Het
Astn1 A T 1: 158,472,389 T100S possibly damaging Het
B3galt1 A C 2: 68,118,579 I213L possibly damaging Het
B4galnt4 A G 7: 141,064,323 K101E probably benign Het
Camsap2 A G 1: 136,292,888 S324P probably damaging Het
Chrnb4 A G 9: 55,043,800 S60P probably damaging Het
Cpne1 A G 2: 156,078,750 probably null Het
Cubn G A 2: 13,491,689 probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cxcl15 T C 5: 90,801,294 M106T probably benign Het
Cyp2c23 A T 19: 44,016,810 M140K probably damaging Het
Dgke A G 11: 89,060,075 F104S probably benign Het
Dhx36 T A 3: 62,472,729 M849L probably benign Het
Dnah7a C T 1: 53,544,511 E1522K possibly damaging Het
Edil3 G T 13: 89,177,178 V219F probably damaging Het
Egln1 A G 8: 124,948,495 V187A possibly damaging Het
Fam193a T C 5: 34,439,378 I455T possibly damaging Het
Fdft1 A T 14: 63,163,420 I88N probably damaging Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Frs2 T A 10: 117,074,582 S292C probably damaging Het
Gm15448 T C 7: 3,821,782 T533A possibly damaging Het
Gpr107 T A 2: 31,171,994 F145I probably benign Het
Gpr153 T A 4: 152,279,373 C83* probably null Het
H2-Q7 T G 17: 35,440,186 probably null Het
Kcnk1 C A 8: 126,025,289 N211K probably damaging Het
Klb T C 5: 65,379,727 V800A probably benign Het
Lat2 T C 5: 134,606,783 Y59C probably damaging Het
Mlkl A T 8: 111,327,801 probably benign Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mtbp T A 15: 55,562,942 C93* probably null Het
Myo7a A G 7: 98,081,180 probably benign Het
Myt1 G A 2: 181,807,387 probably benign Het
Ogfrl1 T C 1: 23,375,754 Q224R possibly damaging Het
Olfr418 A G 1: 173,271,002 T276A probably benign Het
Olfr661 A T 7: 104,688,819 H268L probably damaging Het
Osbpl2 A G 2: 180,150,290 probably benign Het
Plb1 C T 5: 32,284,920 T252M possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbsn T C 6: 92,189,693 T657A probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rps6kb2 C A 19: 4,157,883 S348I probably benign Het
Rsrp1 C T 4: 134,924,257 R111W unknown Het
Ryr3 T C 2: 112,732,982 T2933A probably benign Het
Scara5 A G 14: 65,731,019 D247G possibly damaging Het
Slc7a11 C T 3: 50,424,096 S231N probably benign Het
Sod2 A T 17: 13,010,564 N91Y probably damaging Het
Spesp1 A T 9: 62,272,685 S314T probably benign Het
St3gal1 C A 15: 67,113,687 M39I probably benign Het
Stat6 A T 10: 127,658,241 I646F probably damaging Het
Tdrd1 A T 19: 56,865,978 K1119* probably null Het
Thbs2 A G 17: 14,679,815 I600T probably benign Het
Tor1a A G 2: 30,963,838 V160A probably damaging Het
Trdmt1 T G 2: 13,523,438 D104A probably benign Het
Trim58 T C 11: 58,651,393 V393A probably benign Het
Trip4 C T 9: 65,884,918 probably benign Het
Trip6 T C 5: 137,310,821 E341G probably benign Het
Ttn T A 2: 76,715,195 I32595F probably damaging Het
Ubr4 T A 4: 139,428,028 probably null Het
Ush2a G A 1: 188,864,693 V3877I probably benign Het
Vmn1r29 G T 6: 58,307,732 G146C probably damaging Het
Vmn2r53 A G 7: 12,581,780 V704A probably benign Het
Vmn2r7 C T 3: 64,716,367 M268I probably benign Het
Wnt7b G A 15: 85,537,495 T248M probably damaging Het
Xab2 G A 8: 3,613,649 P394S possibly damaging Het
Zfp663 A G 2: 165,359,075 V13A probably damaging Het
Other mutations in Hsp90b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01550:Hsp90b1 APN 10 86704370 missense probably benign 0.40
IGL01671:Hsp90b1 APN 10 86704325 missense probably benign 0.07
IGL01673:Hsp90b1 APN 10 86693432 missense probably damaging 0.99
IGL02097:Hsp90b1 APN 10 86691684 unclassified probably benign
IGL02124:Hsp90b1 APN 10 86705358 unclassified probably benign
IGL02257:Hsp90b1 APN 10 86698589 missense probably damaging 1.00
IGL02339:Hsp90b1 APN 10 86701814 missense probably damaging 1.00
IGL02342:Hsp90b1 APN 10 86695739 critical splice acceptor site probably null
R0329:Hsp90b1 UTSW 10 86694155 missense probably damaging 1.00
R0330:Hsp90b1 UTSW 10 86694155 missense probably damaging 1.00
R1531:Hsp90b1 UTSW 10 86696795 missense probably benign 0.02
R1540:Hsp90b1 UTSW 10 86694042 missense probably damaging 1.00
R1711:Hsp90b1 UTSW 10 86694525 missense probably damaging 1.00
R1797:Hsp90b1 UTSW 10 86701745 missense possibly damaging 0.86
R2128:Hsp90b1 UTSW 10 86695706 missense probably damaging 1.00
R2129:Hsp90b1 UTSW 10 86695706 missense probably damaging 1.00
R2903:Hsp90b1 UTSW 10 86703485 missense probably damaging 1.00
R4735:Hsp90b1 UTSW 10 86693955 missense probably damaging 1.00
R4749:Hsp90b1 UTSW 10 86701808 missense probably damaging 1.00
R5011:Hsp90b1 UTSW 10 86696753 missense probably benign 0.37
R5650:Hsp90b1 UTSW 10 86693503 missense probably damaging 1.00
R5950:Hsp90b1 UTSW 10 86701745 missense possibly damaging 0.86
R6731:Hsp90b1 UTSW 10 86701905 missense probably benign 0.01
R6835:Hsp90b1 UTSW 10 86694085 missense probably damaging 1.00
R7038:Hsp90b1 UTSW 10 86695866 missense probably damaging 0.99
R7250:Hsp90b1 UTSW 10 86691708 missense unknown
R7343:Hsp90b1 UTSW 10 86692183 missense probably damaging 1.00
R8027:Hsp90b1 UTSW 10 86696730 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGACTCCAACCATCGGGCAGAAAG -3'
(R):5'- TGTGACCTGAATAACCAAGCAAGGC -3'

Sequencing Primer
(F):5'- GGAGATCATCGGAATCCACCTG -3'
(R):5'- TTTCCACAGGAAAGTGATGACC -3'
Posted On2013-09-03