Incidental Mutation 'R8962:Ddx10'
ID 682401
Institutional Source Beutler Lab
Gene Symbol Ddx10
Ensembl Gene ENSMUSG00000053289
Gene Name DEAD box helicase 10
Synonyms 4632415A01Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 10
MMRRC Submission 068796-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.959) question?
Stock # R8962 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 53009935-53159353 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 53149377 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 117 (S117P)
Ref Sequence ENSEMBL: ENSMUSP00000065198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065630]
AlphaFold Q80Y44
Predicted Effect probably damaging
Transcript: ENSMUST00000065630
AA Change: S117P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065198
Gene: ENSMUSG00000053289
AA Change: S117P

DomainStartEndE-ValueType
low complexity region 24 43 N/A INTRINSIC
DEXDc 88 291 1.74e-53 SMART
HELICc 327 410 8.48e-25 SMART
DUF4217 450 513 6.06e-25 SMART
low complexity region 577 594 N/A INTRINSIC
low complexity region 627 637 N/A INTRINSIC
low complexity region 658 680 N/A INTRINSIC
low complexity region 748 773 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, and it may be involved in ribosome assembly. Fusion of this gene and the nucleoporin gene, NUP98, by inversion 11 (p15q22) chromosome translocation is found in the patients with de novo or therapy-related myeloid malignancies. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit craniofacial defects, including decreased cranium length, cleft palate, and short snout, and show reduced body size, body weight, lean body mass, and bone mineral content. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik T A 9: 46,220,173 (GRCm39) M120L probably benign Het
Abat A G 16: 8,396,166 (GRCm39) T48A probably damaging Het
Abca8a A T 11: 109,969,634 (GRCm39) I314N probably damaging Het
Abr A T 11: 76,352,155 (GRCm39) V108D probably damaging Het
Adamts17 T G 7: 66,725,057 (GRCm39) L162V probably damaging Het
Adamts6 A T 13: 104,433,899 (GRCm39) K109N probably damaging Het
Ago3 A G 4: 126,241,595 (GRCm39) F68S probably damaging Het
Aifm3 T C 16: 17,324,200 (GRCm39) probably null Het
Ankrd26 T C 6: 118,512,104 (GRCm39) E506G probably benign Het
Apaf1 A G 10: 90,903,066 (GRCm39) L185P probably damaging Het
Atp8b3 G T 10: 80,355,896 (GRCm39) T1272K probably benign Het
Cars2 A G 8: 11,587,304 (GRCm39) V193A probably benign Het
Ccn5 C T 2: 163,667,160 (GRCm39) R54* probably null Het
Ccr8 A T 9: 119,923,613 (GRCm39) I243F possibly damaging Het
Col12a1 A G 9: 79,538,901 (GRCm39) V2465A probably damaging Het
Ctbp1 T C 5: 33,416,616 (GRCm39) N127S probably benign Het
Dgkb T C 12: 38,189,494 (GRCm39) probably null Het
Dnah11 T A 12: 117,916,273 (GRCm39) D3520V probably damaging Het
Dnah11 C T 12: 117,918,630 (GRCm39) D1530N probably damaging Het
Dock5 T C 14: 67,994,640 (GRCm39) T1807A probably benign Het
Drd3 C T 16: 43,641,842 (GRCm39) T386I probably damaging Het
Dsg1b A G 18: 20,542,316 (GRCm39) N941S probably damaging Het
Enpp3 T C 10: 24,696,513 (GRCm39) T141A probably benign Het
Esyt1 A T 10: 128,356,566 (GRCm39) C360S possibly damaging Het
Ethe1 T A 7: 24,305,682 (GRCm39) V143D probably damaging Het
Fam170b A G 14: 32,557,336 (GRCm39) D57G probably benign Het
Fam53c T C 18: 34,901,229 (GRCm39) S49P probably damaging Het
Fbp1 G A 13: 63,023,067 (GRCm39) L77F probably benign Het
Gm17093 A G 14: 44,758,149 (GRCm39) E110G Het
Gm21976 G T 13: 98,423,821 (GRCm39) silent Het
Golgb1 T C 16: 36,733,978 (GRCm39) I1075T probably damaging Het
Grip2 T C 6: 91,754,391 (GRCm39) D628G probably damaging Het
Gtpbp1 G T 15: 79,601,929 (GRCm39) L557F probably benign Het
Ighv12-3 A T 12: 114,330,204 (GRCm39) F97Y probably benign Het
Itga8 T C 2: 12,196,045 (GRCm39) H635R possibly damaging Het
Itgb7 A G 15: 102,127,037 (GRCm39) L466S probably damaging Het
Klc2 T C 19: 5,161,864 (GRCm39) D277G probably benign Het
Ktn1 A G 14: 47,901,248 (GRCm39) E2G probably damaging Het
Lcmt1 T A 7: 123,000,669 (GRCm39) Y68N probably damaging Het
Marchf10 G T 11: 105,280,815 (GRCm39) S490* probably null Het
Mterf1b A T 5: 4,246,437 (GRCm39) Y26F probably benign Het
Myo18b T A 5: 113,006,346 (GRCm39) I855F probably benign Het
Nek4 G A 14: 30,675,915 (GRCm39) M83I probably damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nos1 T C 5: 118,017,405 (GRCm39) V256A probably benign Het
Nr1h2 T C 7: 44,201,463 (GRCm39) T50A probably benign Het
Or14c42-ps1 T A 7: 86,211,317 (GRCm39) *126K probably null Het
Or4n4 A C 14: 50,518,816 (GRCm39) M298R possibly damaging Het
Ovol2 G C 2: 144,147,834 (GRCm39) R172G probably damaging Het
Parp14 A G 16: 35,677,187 (GRCm39) I927T probably damaging Het
Pcdhga7 T A 18: 37,848,879 (GRCm39) H295Q probably benign Het
Pkhd1l1 C T 15: 44,400,291 (GRCm39) T2145I probably damaging Het
Plekhs1 C T 19: 56,461,680 (GRCm39) T139I possibly damaging Het
Rab11fip3 T A 17: 26,231,007 (GRCm39) D746V probably damaging Het
Rnf214 A C 9: 45,809,728 (GRCm39) probably null Het
Rtn4ip1 A T 10: 43,822,415 (GRCm39) probably null Het
S1pr1 T C 3: 115,505,569 (GRCm39) R342G Het
Serpina1f T C 12: 103,656,131 (GRCm39) S366G probably benign Het
Sestd1 A T 2: 77,042,708 (GRCm39) M282K probably benign Het
Siglecf T G 7: 43,001,140 (GRCm39) V36G probably damaging Het
Slc1a1 T C 19: 28,886,869 (GRCm39) V410A probably damaging Het
Slc38a4 C A 15: 96,917,684 (GRCm39) D14Y probably benign Het
Slk C T 19: 47,610,748 (GRCm39) T806M probably damaging Het
Slurp2 C A 15: 74,615,249 (GRCm39) V48F possibly damaging Het
Socs1 A G 16: 10,602,642 (GRCm39) S32P possibly damaging Het
Son T C 16: 91,455,057 (GRCm39) V1268A possibly damaging Het
Sp7 C A 15: 102,274,880 (GRCm39) probably benign Het
Speer4a2 T G 5: 26,290,745 (GRCm39) E142A probably benign Het
Taar7b T G 10: 23,876,359 (GRCm39) S175A probably benign Het
Tet2 T C 3: 133,193,804 (GRCm39) N210S probably benign Het
Tkfc T C 19: 10,570,700 (GRCm39) D492G probably damaging Het
Tmc7 G A 7: 118,160,228 (GRCm39) P203L probably benign Het
Trmt9b A G 8: 36,972,729 (GRCm39) K60E probably damaging Het
Tshz2 C A 2: 169,726,524 (GRCm39) F373L probably damaging Het
Ttc29 T A 8: 79,042,336 (GRCm39) L307Q probably damaging Het
Tubd1 G A 11: 86,439,659 (GRCm39) M1I probably null Het
Vmn1r62 T A 7: 5,678,601 (GRCm39) M94K probably damaging Het
Vmn2r125 T C 4: 156,703,186 (GRCm39) I188T possibly damaging Het
Vmn2r5 T C 3: 64,398,564 (GRCm39) D805G probably damaging Het
Vmn2r6 A T 3: 64,463,576 (GRCm39) D419E probably damaging Het
Vps39 A T 2: 120,174,687 (GRCm39) Y98* probably null Het
Zdbf2 G A 1: 63,347,162 (GRCm39) G1847D probably benign Het
Zdhhc6 T C 19: 55,287,239 (GRCm39) E407G probably benign Het
Zfp407 A G 18: 84,577,057 (GRCm39) I1352T probably damaging Het
Zfp607a A G 7: 27,578,786 (GRCm39) K619E possibly damaging Het
Zfp811 A T 17: 33,017,622 (GRCm39) N139K probably benign Het
Other mutations in Ddx10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Ddx10 APN 9 53,071,326 (GRCm39) splice site probably benign
IGL01111:Ddx10 APN 9 53,071,248 (GRCm39) missense possibly damaging 0.73
IGL01773:Ddx10 APN 9 53,115,430 (GRCm39) missense possibly damaging 0.94
IGL01837:Ddx10 APN 9 53,140,498 (GRCm39) missense probably benign 0.16
IGL02036:Ddx10 APN 9 53,115,483 (GRCm39) missense probably benign 0.00
IGL02236:Ddx10 APN 9 53,146,682 (GRCm39) missense probably damaging 1.00
IGL02939:Ddx10 APN 9 53,115,579 (GRCm39) missense possibly damaging 0.63
IGL03294:Ddx10 APN 9 53,028,452 (GRCm39) critical splice donor site probably null
R0279:Ddx10 UTSW 9 53,146,604 (GRCm39) missense probably damaging 1.00
R1439:Ddx10 UTSW 9 53,151,787 (GRCm39) missense probably damaging 1.00
R1501:Ddx10 UTSW 9 53,145,297 (GRCm39) missense possibly damaging 0.85
R1529:Ddx10 UTSW 9 53,028,499 (GRCm39) nonsense probably null
R1548:Ddx10 UTSW 9 53,060,861 (GRCm39) critical splice acceptor site probably null
R1717:Ddx10 UTSW 9 53,071,253 (GRCm39) missense probably benign 0.25
R1720:Ddx10 UTSW 9 53,149,371 (GRCm39) missense probably damaging 1.00
R1781:Ddx10 UTSW 9 53,118,845 (GRCm39) missense probably damaging 1.00
R2005:Ddx10 UTSW 9 53,151,775 (GRCm39) critical splice donor site probably null
R2007:Ddx10 UTSW 9 53,124,578 (GRCm39) missense probably benign 0.06
R2073:Ddx10 UTSW 9 53,151,805 (GRCm39) missense probably benign 0.28
R2075:Ddx10 UTSW 9 53,151,805 (GRCm39) missense probably benign 0.28
R2133:Ddx10 UTSW 9 53,060,812 (GRCm39) missense probably benign 0.13
R4660:Ddx10 UTSW 9 53,147,698 (GRCm39) critical splice donor site probably null
R4668:Ddx10 UTSW 9 53,010,513 (GRCm39) missense possibly damaging 0.55
R4706:Ddx10 UTSW 9 53,145,231 (GRCm39) missense probably damaging 1.00
R4814:Ddx10 UTSW 9 53,115,405 (GRCm39) missense possibly damaging 0.54
R5394:Ddx10 UTSW 9 53,145,157 (GRCm39) nonsense probably null
R5655:Ddx10 UTSW 9 53,120,987 (GRCm39) critical splice donor site probably null
R5874:Ddx10 UTSW 9 53,140,498 (GRCm39) missense possibly damaging 0.95
R6341:Ddx10 UTSW 9 53,115,551 (GRCm39) missense probably benign 0.00
R6534:Ddx10 UTSW 9 53,134,988 (GRCm39) missense probably damaging 1.00
R6801:Ddx10 UTSW 9 53,159,207 (GRCm39) nonsense probably null
R6994:Ddx10 UTSW 9 53,115,411 (GRCm39) missense probably damaging 0.99
R7155:Ddx10 UTSW 9 53,028,588 (GRCm39) missense probably benign 0.00
R7380:Ddx10 UTSW 9 53,151,786 (GRCm39) missense probably damaging 1.00
R7753:Ddx10 UTSW 9 53,136,904 (GRCm39) missense probably damaging 1.00
R8101:Ddx10 UTSW 9 53,136,820 (GRCm39) missense probably damaging 0.98
R8782:Ddx10 UTSW 9 53,146,588 (GRCm39) missense probably damaging 0.99
R8998:Ddx10 UTSW 9 53,140,534 (GRCm39) missense possibly damaging 0.64
R8999:Ddx10 UTSW 9 53,140,534 (GRCm39) missense possibly damaging 0.64
R9283:Ddx10 UTSW 9 53,146,656 (GRCm39) missense probably benign 0.01
X0019:Ddx10 UTSW 9 53,145,296 (GRCm39) missense probably damaging 1.00
X0063:Ddx10 UTSW 9 53,136,873 (GRCm39) missense probably damaging 1.00
Z1177:Ddx10 UTSW 9 53,115,811 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTACTGAGTGCCTTCCATGGG -3'
(R):5'- GACATACAATCAAGCCTGTGGTG -3'

Sequencing Primer
(F):5'- TGGGCACAGCACTGTCATAC -3'
(R):5'- GTGTGGCATCATCCATTAAGAG -3'
Posted On 2021-08-31