Mutagenetix > Incidental Mutation

Incidental Mutation 'R8962:Atp8b3'

682408

Institutional Source

Beutler Lab

Gene Symbol

Atp8b3

Ensembl Gene

ENSMUSG00000003341

Gene Name

ATPase, class I, type 8B, member 3

Synonyms

1700042F02Rik, SAPLT, 1700056N23Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.118) question?

Stock #

R8962 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80519584-80539124 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 80520062 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 1272 (T1272K)

Ref Sequence

ENSEMBL: ENSMUSP00000020383 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000051773] [ENSMUST00000220326]

AlphaFold

Q6UQ17

Predicted Effect

probably benign
Transcript: ENSMUST00000020383
AA Change: T1272K

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: T1272K

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	20	97	9.3e-29	PFAM
Pfam:E1-E2_ATPase	121	367	2.2e-10	PFAM
Pfam:HAD	404	866	3.7e-17	PFAM
Pfam:Cation_ATPase	481	580	8.3e-12	PFAM
Pfam:PhoLip_ATPase_C	883	1135	4.2e-61	PFAM
low complexity region	1140	1153	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000051773

SMART Domains

Protein: ENSMUSP00000053288
Gene: ENSMUSG00000045518

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
low complexity region	56	76	N/A	INTRINSIC
low complexity region	98	116	N/A	INTRINSIC
low complexity region	126	151	N/A	INTRINSIC
low complexity region	190	227	N/A	INTRINSIC
CUT	310	395	1.24e-42	SMART
HOX	411	473	1.07e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000220326

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.4%

Validation Efficiency

99% (86/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931429L15Rik	T	A	9: 46,308,875	M120L	probably benign	Het
6430573F11Rik	A	G	8: 36,505,575	K60E	probably damaging	Het
Abat	A	G	16: 8,578,302	T48A	probably damaging	Het
Abca8a	A	T	11: 110,078,808	I314N	probably damaging	Het
Abr	A	T	11: 76,461,329	V108D	probably damaging	Het
Adamts17	T	G	7: 67,075,309	L162V	probably damaging	Het
Adamts6	A	T	13: 104,297,391	K109N	probably damaging	Het
Ago3	A	G	4: 126,347,802	F68S	probably damaging	Het
Aifm3	T	C	16: 17,506,336		probably null	Het
Ankrd26	T	C	6: 118,535,143	E506G	probably benign	Het
Apaf1	A	G	10: 91,067,204	L185P	probably damaging	Het
Cars2	A	G	8: 11,537,304	V193A	probably benign	Het
Ccr8	A	T	9: 120,094,547	I243F	possibly damaging	Het
Col12a1	A	G	9: 79,631,619	V2465A	probably damaging	Het
Ctbp1	T	C	5: 33,259,272	N127S	probably benign	Het
Ddx10	A	G	9: 53,238,077	S117P	probably damaging	Het
Dgkb	T	C	12: 38,139,495		probably null	Het
Dnah11	T	A	12: 117,952,538	D3520V	probably damaging	Het
Dnah11	C	T	12: 117,954,895	D1530N	probably damaging	Het
Dock5	T	C	14: 67,757,191	T1807A	probably benign	Het
Drd3	C	T	16: 43,821,479	T386I	probably damaging	Het
Dsg1b	A	G	18: 20,409,259	N941S	probably damaging	Het
Enpp3	T	C	10: 24,820,615	T141A	probably benign	Het
Esyt1	A	T	10: 128,520,697	C360S	possibly damaging	Het
Ethe1	T	A	7: 24,606,257	V143D	probably damaging	Het
Fam170b	A	G	14: 32,835,379	D57G	probably benign	Het
Fam53c	T	C	18: 34,768,176	S49P	probably damaging	Het
Fbp1	G	A	13: 62,875,253	L77F	probably benign	Het
Gm10471	T	G	5: 26,085,747	E142A	probably benign	Het
Gm17093	A	G	14: 44,520,692	E110G		Het
Gm21976	G	T	13: 98,287,313		silent	Het
Golgb1	T	C	16: 36,913,616	I1075T	probably damaging	Het
Grip2	T	C	6: 91,777,410	D628G	probably damaging	Het
Gtpbp1	G	T	15: 79,717,728	L557F	probably benign	Het
Ighv12-3	A	T	12: 114,366,584	F97Y	probably benign	Het
Itga8	T	C	2: 12,191,234	H635R	possibly damaging	Het
Itgb7	A	G	15: 102,218,602	L466S	probably damaging	Het
Klc2	T	C	19: 5,111,836	D277G	probably benign	Het
Ktn1	A	G	14: 47,663,791	E2G	probably damaging	Het
Lcmt1	T	A	7: 123,401,446	Y68N	probably damaging	Het
March10	G	T	11: 105,389,989	S490*	probably null	Het
Mterf1b	A	T	5: 4,196,437	Y26F	probably benign	Het
Myo18b	T	A	5: 112,858,480	I855F	probably benign	Het
Nek4	G	A	14: 30,953,958	M83I	probably damaging	Het
Nicn1	C	T	9: 108,294,509	R163C	possibly damaging	Het
Nos1	T	C	5: 117,879,340	V256A	probably benign	Het
Nr1h2	T	C	7: 44,552,039	T50A	probably benign	Het
Olfr296-ps1	T	A	7: 86,562,109	*126K	probably null	Het
Olfr732	A	C	14: 50,281,359	M298R	possibly damaging	Het
Ovol2	G	C	2: 144,305,914	R172G	probably damaging	Het
Parp14	A	G	16: 35,856,817	I927T	probably damaging	Het
Pcdhga7	T	A	18: 37,715,826	H295Q	probably benign	Het
Pkhd1l1	C	T	15: 44,536,895	T2145I	probably damaging	Het
Plekhs1	C	T	19: 56,473,248	T139I	possibly damaging	Het
Rab11fip3	T	A	17: 26,012,033	D746V	probably damaging	Het
Rnf214	A	C	9: 45,898,430		probably null	Het
Rtn4ip1	A	T	10: 43,946,419		probably null	Het
S1pr1	T	C	3: 115,711,920	R342G		Het
Serpina1f	T	C	12: 103,689,872	S366G	probably benign	Het
Sestd1	A	T	2: 77,212,364	M282K	probably benign	Het
Siglecf	T	G	7: 43,351,716	V36G	probably damaging	Het
Slc1a1	T	C	19: 28,909,469	V410A	probably damaging	Het
Slc38a4	C	A	15: 97,019,803	D14Y	probably benign	Het
Slk	C	T	19: 47,622,309	T806M	probably damaging	Het
Slurp2	C	A	15: 74,743,400	V48F	possibly damaging	Het
Socs1	A	G	16: 10,784,778	S32P	possibly damaging	Het
Son	T	C	16: 91,658,169	V1268A	possibly damaging	Het
Sp7	C	A	15: 102,366,445		probably benign	Het
Taar7b	T	G	10: 24,000,461	S175A	probably benign	Het
Tet2	T	C	3: 133,488,043	N210S	probably benign	Het
Tkfc	T	C	19: 10,593,336	D492G	probably damaging	Het
Tmc7	G	A	7: 118,561,005	P203L	probably benign	Het
Tshz2	C	A	2: 169,884,604	F373L	probably damaging	Het
Ttc29	T	A	8: 78,315,707	L307Q	probably damaging	Het
Tubd1	G	A	11: 86,548,833	M1I	probably null	Het
Vmn1r62	T	A	7: 5,675,602	M94K	probably damaging	Het
Vmn2r125	T	C	4: 156,350,891	I188T	possibly damaging	Het
Vmn2r5	T	C	3: 64,491,143	D805G	probably damaging	Het
Vmn2r6	A	T	3: 64,556,155	D419E	probably damaging	Het
Vps39	A	T	2: 120,344,206	Y98*	probably null	Het
Wisp2	C	T	2: 163,825,240	R54*	probably null	Het
Zdbf2	G	A	1: 63,308,003	G1847D	probably benign	Het
Zdhhc6	T	C	19: 55,298,807	E407G	probably benign	Het
Zfp407	A	G	18: 84,558,932	I1352T	probably damaging	Het
Zfp607a	A	G	7: 27,879,361	K619E	possibly damaging	Het
Zfp811	A	T	17: 32,798,648	N139K	probably benign	Het

Other mutations in Atp8b3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Atp8b3	APN	10	80530987	missense	probably damaging	1.00
IGL00484:Atp8b3	APN	10	80526164	splice site	probably benign
IGL00904:Atp8b3	APN	10	80528764	missense	probably damaging	1.00
IGL01326:Atp8b3	APN	10	80524376	missense	probably damaging	0.98
IGL01368:Atp8b3	APN	10	80534229	splice site	probably benign
IGL01448:Atp8b3	APN	10	80520422	missense	probably benign	0.02
IGL01556:Atp8b3	APN	10	80530968	nonsense	probably null
IGL01754:Atp8b3	APN	10	80530961	splice site	probably null
IGL01809:Atp8b3	APN	10	80520011	missense	probably benign	0.02
IGL01895:Atp8b3	APN	10	80521828	missense	possibly damaging	0.80
IGL02184:Atp8b3	APN	10	80527233	splice site	probably benign
IGL02224:Atp8b3	APN	10	80525976	splice site	probably benign
IGL02377:Atp8b3	APN	10	80520294	missense	probably benign	0.06
IGL02405:Atp8b3	APN	10	80530628	missense	probably damaging	1.00
IGL03090:Atp8b3	APN	10	80530604	missense	probably damaging	1.00
IGL03244:Atp8b3	APN	10	80534458	missense	probably damaging	1.00
PIT4544001:Atp8b3	UTSW	10	80530586	missense	probably benign	0.14
R0277:Atp8b3	UTSW	10	80526909	missense	probably benign	0.21
R0908:Atp8b3	UTSW	10	80520084	missense	probably benign	0.03
R0973:Atp8b3	UTSW	10	80534198	missense	probably damaging	1.00
R1069:Atp8b3	UTSW	10	80531018	missense	probably damaging	1.00
R1087:Atp8b3	UTSW	10	80520183	missense	probably benign	0.00
R1553:Atp8b3	UTSW	10	80532542	missense	probably damaging	1.00
R1603:Atp8b3	UTSW	10	80525785	missense	probably benign	0.06
R1606:Atp8b3	UTSW	10	80532578	missense	probably damaging	1.00
R1707:Atp8b3	UTSW	10	80521801	splice site	probably null
R1717:Atp8b3	UTSW	10	80528797	missense	probably damaging	1.00
R1876:Atp8b3	UTSW	10	80530078	missense	possibly damaging	0.70
R1939:Atp8b3	UTSW	10	80525386	nonsense	probably null
R2138:Atp8b3	UTSW	10	80527105	missense	possibly damaging	0.79
R2239:Atp8b3	UTSW	10	80530988	missense	probably damaging	1.00
R2429:Atp8b3	UTSW	10	80526894	missense	probably benign	0.02
R2696:Atp8b3	UTSW	10	80534183	missense	possibly damaging	0.94
R2910:Atp8b3	UTSW	10	80519912	missense	possibly damaging	0.90
R3424:Atp8b3	UTSW	10	80536347	missense	probably benign	0.35
R3425:Atp8b3	UTSW	10	80536347	missense	probably benign	0.35
R3432:Atp8b3	UTSW	10	80526180	missense	probably benign	0.10
R3841:Atp8b3	UTSW	10	80529706	missense	possibly damaging	0.95
R4515:Atp8b3	UTSW	10	80523847	missense	probably benign
R4518:Atp8b3	UTSW	10	80523847	missense	probably benign
R4519:Atp8b3	UTSW	10	80523847	missense	probably benign
R4619:Atp8b3	UTSW	10	80526024	missense	possibly damaging	0.67
R4648:Atp8b3	UTSW	10	80525623	missense	possibly damaging	0.94
R4709:Atp8b3	UTSW	10	80536770	splice site	probably null
R4774:Atp8b3	UTSW	10	80536322	missense	probably damaging	1.00
R4796:Atp8b3	UTSW	10	80524354	missense	probably damaging	1.00
R5000:Atp8b3	UTSW	10	80521842	missense	possibly damaging	0.82
R5398:Atp8b3	UTSW	10	80529699	missense	probably damaging	1.00
R5778:Atp8b3	UTSW	10	80520173	missense	probably benign
R5990:Atp8b3	UTSW	10	80525697	missense	possibly damaging	0.65
R6124:Atp8b3	UTSW	10	80529681	missense	probably damaging	1.00
R6427:Atp8b3	UTSW	10	80520323	splice site	probably null
R6748:Atp8b3	UTSW	10	80525224	missense	possibly damaging	0.56
R6756:Atp8b3	UTSW	10	80526061	missense	possibly damaging	0.76
R7051:Atp8b3	UTSW	10	80520024	missense	probably benign	0.02
R7051:Atp8b3	UTSW	10	80529718	missense	probably damaging	0.99
R7052:Atp8b3	UTSW	10	80520024	missense	probably benign	0.02
R7418:Atp8b3	UTSW	10	80530092	missense	probably damaging	0.99
R7426:Atp8b3	UTSW	10	80529629	critical splice donor site	probably null
R7625:Atp8b3	UTSW	10	80520146	missense	probably benign	0.00
R7673:Atp8b3	UTSW	10	80524406	missense	probably damaging	0.99
R7921:Atp8b3	UTSW	10	80530603	missense	probably damaging	1.00
R8077:Atp8b3	UTSW	10	80531024	missense	possibly damaging	0.95
R8235:Atp8b3	UTSW	10	80529816	missense	probably damaging	0.96
R8354:Atp8b3	UTSW	10	80525799	missense	probably benign	0.00
R8454:Atp8b3	UTSW	10	80525799	missense	probably benign	0.00
R8501:Atp8b3	UTSW	10	80520146	missense	probably benign
R8712:Atp8b3	UTSW	10	80530089	missense	possibly damaging	0.52
R9129:Atp8b3	UTSW	10	80532578	missense	probably damaging	1.00
R9333:Atp8b3	UTSW	10	80524346	missense	probably benign	0.01
R9438:Atp8b3	UTSW	10	80525575	missense	probably damaging	1.00
R9486:Atp8b3	UTSW	10	80530987	missense	probably damaging	1.00
R9554:Atp8b3	UTSW	10	80524363	missense	probably damaging	1.00
R9570:Atp8b3	UTSW	10	80525988	missense	probably benign	0.05
R9682:Atp8b3	UTSW	10	80535396	missense	probably damaging	1.00
R9748:Atp8b3	UTSW	10	80528573	missense	probably damaging	0.96
RF006:Atp8b3	UTSW	10	80526236	missense	probably benign	0.15
Z1177:Atp8b3	UTSW	10	80531077	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TGGGCCTCTGGTCAACTTTG -3'
(R):5'- CCCGAAGAAGACATTCCCTTG -3'

Sequencing Primer
(F):5'- CAACTTTGCTTTCTGGGGAC -3'
(R):5'- TTCCCTTGCAAAACAAAGATTCAG -3'

Posted On

2021-08-31