Incidental Mutation 'R8962:Or4n4'
ID 682426
Institutional Source Beutler Lab
Gene Symbol Or4n4
Ensembl Gene ENSMUSG00000091873
Gene Name olfactory receptor family 4 subfamily N member 4
Synonyms GA_x6K02T2PMLR-5975274-5974348, Olfr732, MOR241-1
MMRRC Submission 068796-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R8962 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 50518685-50519728 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 50518816 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Arginine at position 298 (M298R)
Ref Sequence ENSEMBL: ENSMUSP00000148984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071208] [ENSMUST00000213701]
AlphaFold Q8VFT5
Predicted Effect possibly damaging
Transcript: ENSMUST00000071208
AA Change: M298R

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000071195
Gene: ENSMUSG00000091873
AA Change: M298R

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 7.4e-45 PFAM
Pfam:7tm_1 41 288 4.5e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213701
AA Change: M298R

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik T A 9: 46,220,173 (GRCm39) M120L probably benign Het
Abat A G 16: 8,396,166 (GRCm39) T48A probably damaging Het
Abca8a A T 11: 109,969,634 (GRCm39) I314N probably damaging Het
Abr A T 11: 76,352,155 (GRCm39) V108D probably damaging Het
Adamts17 T G 7: 66,725,057 (GRCm39) L162V probably damaging Het
Adamts6 A T 13: 104,433,899 (GRCm39) K109N probably damaging Het
Ago3 A G 4: 126,241,595 (GRCm39) F68S probably damaging Het
Aifm3 T C 16: 17,324,200 (GRCm39) probably null Het
Ankrd26 T C 6: 118,512,104 (GRCm39) E506G probably benign Het
Apaf1 A G 10: 90,903,066 (GRCm39) L185P probably damaging Het
Atp8b3 G T 10: 80,355,896 (GRCm39) T1272K probably benign Het
Cars2 A G 8: 11,587,304 (GRCm39) V193A probably benign Het
Ccn5 C T 2: 163,667,160 (GRCm39) R54* probably null Het
Ccr8 A T 9: 119,923,613 (GRCm39) I243F possibly damaging Het
Col12a1 A G 9: 79,538,901 (GRCm39) V2465A probably damaging Het
Ctbp1 T C 5: 33,416,616 (GRCm39) N127S probably benign Het
Ddx10 A G 9: 53,149,377 (GRCm39) S117P probably damaging Het
Dgkb T C 12: 38,189,494 (GRCm39) probably null Het
Dnah11 T A 12: 117,916,273 (GRCm39) D3520V probably damaging Het
Dnah11 C T 12: 117,918,630 (GRCm39) D1530N probably damaging Het
Dock5 T C 14: 67,994,640 (GRCm39) T1807A probably benign Het
Drd3 C T 16: 43,641,842 (GRCm39) T386I probably damaging Het
Dsg1b A G 18: 20,542,316 (GRCm39) N941S probably damaging Het
Enpp3 T C 10: 24,696,513 (GRCm39) T141A probably benign Het
Esyt1 A T 10: 128,356,566 (GRCm39) C360S possibly damaging Het
Ethe1 T A 7: 24,305,682 (GRCm39) V143D probably damaging Het
Fam170b A G 14: 32,557,336 (GRCm39) D57G probably benign Het
Fam53c T C 18: 34,901,229 (GRCm39) S49P probably damaging Het
Fbp1 G A 13: 63,023,067 (GRCm39) L77F probably benign Het
Gm17093 A G 14: 44,758,149 (GRCm39) E110G Het
Gm21976 G T 13: 98,423,821 (GRCm39) silent Het
Golgb1 T C 16: 36,733,978 (GRCm39) I1075T probably damaging Het
Grip2 T C 6: 91,754,391 (GRCm39) D628G probably damaging Het
Gtpbp1 G T 15: 79,601,929 (GRCm39) L557F probably benign Het
Ighv12-3 A T 12: 114,330,204 (GRCm39) F97Y probably benign Het
Itga8 T C 2: 12,196,045 (GRCm39) H635R possibly damaging Het
Itgb7 A G 15: 102,127,037 (GRCm39) L466S probably damaging Het
Klc2 T C 19: 5,161,864 (GRCm39) D277G probably benign Het
Ktn1 A G 14: 47,901,248 (GRCm39) E2G probably damaging Het
Lcmt1 T A 7: 123,000,669 (GRCm39) Y68N probably damaging Het
Marchf10 G T 11: 105,280,815 (GRCm39) S490* probably null Het
Mterf1b A T 5: 4,246,437 (GRCm39) Y26F probably benign Het
Myo18b T A 5: 113,006,346 (GRCm39) I855F probably benign Het
Nek4 G A 14: 30,675,915 (GRCm39) M83I probably damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nos1 T C 5: 118,017,405 (GRCm39) V256A probably benign Het
Nr1h2 T C 7: 44,201,463 (GRCm39) T50A probably benign Het
Or14c42-ps1 T A 7: 86,211,317 (GRCm39) *126K probably null Het
Ovol2 G C 2: 144,147,834 (GRCm39) R172G probably damaging Het
Parp14 A G 16: 35,677,187 (GRCm39) I927T probably damaging Het
Pcdhga7 T A 18: 37,848,879 (GRCm39) H295Q probably benign Het
Pkhd1l1 C T 15: 44,400,291 (GRCm39) T2145I probably damaging Het
Plekhs1 C T 19: 56,461,680 (GRCm39) T139I possibly damaging Het
Rab11fip3 T A 17: 26,231,007 (GRCm39) D746V probably damaging Het
Rnf214 A C 9: 45,809,728 (GRCm39) probably null Het
Rtn4ip1 A T 10: 43,822,415 (GRCm39) probably null Het
S1pr1 T C 3: 115,505,569 (GRCm39) R342G Het
Serpina1f T C 12: 103,656,131 (GRCm39) S366G probably benign Het
Sestd1 A T 2: 77,042,708 (GRCm39) M282K probably benign Het
Siglecf T G 7: 43,001,140 (GRCm39) V36G probably damaging Het
Slc1a1 T C 19: 28,886,869 (GRCm39) V410A probably damaging Het
Slc38a4 C A 15: 96,917,684 (GRCm39) D14Y probably benign Het
Slk C T 19: 47,610,748 (GRCm39) T806M probably damaging Het
Slurp2 C A 15: 74,615,249 (GRCm39) V48F possibly damaging Het
Socs1 A G 16: 10,602,642 (GRCm39) S32P possibly damaging Het
Son T C 16: 91,455,057 (GRCm39) V1268A possibly damaging Het
Sp7 C A 15: 102,274,880 (GRCm39) probably benign Het
Speer4a2 T G 5: 26,290,745 (GRCm39) E142A probably benign Het
Taar7b T G 10: 23,876,359 (GRCm39) S175A probably benign Het
Tet2 T C 3: 133,193,804 (GRCm39) N210S probably benign Het
Tkfc T C 19: 10,570,700 (GRCm39) D492G probably damaging Het
Tmc7 G A 7: 118,160,228 (GRCm39) P203L probably benign Het
Trmt9b A G 8: 36,972,729 (GRCm39) K60E probably damaging Het
Tshz2 C A 2: 169,726,524 (GRCm39) F373L probably damaging Het
Ttc29 T A 8: 79,042,336 (GRCm39) L307Q probably damaging Het
Tubd1 G A 11: 86,439,659 (GRCm39) M1I probably null Het
Vmn1r62 T A 7: 5,678,601 (GRCm39) M94K probably damaging Het
Vmn2r125 T C 4: 156,703,186 (GRCm39) I188T possibly damaging Het
Vmn2r5 T C 3: 64,398,564 (GRCm39) D805G probably damaging Het
Vmn2r6 A T 3: 64,463,576 (GRCm39) D419E probably damaging Het
Vps39 A T 2: 120,174,687 (GRCm39) Y98* probably null Het
Zdbf2 G A 1: 63,347,162 (GRCm39) G1847D probably benign Het
Zdhhc6 T C 19: 55,287,239 (GRCm39) E407G probably benign Het
Zfp407 A G 18: 84,577,057 (GRCm39) I1352T probably damaging Het
Zfp607a A G 7: 27,578,786 (GRCm39) K619E possibly damaging Het
Zfp811 A T 17: 33,017,622 (GRCm39) N139K probably benign Het
Other mutations in Or4n4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Or4n4 APN 14 50,519,689 (GRCm39) missense probably damaging 0.99
IGL01801:Or4n4 APN 14 50,519,665 (GRCm39) missense probably benign
IGL01992:Or4n4 APN 14 50,518,798 (GRCm39) missense probably benign 0.09
IGL02137:Or4n4 APN 14 50,519,135 (GRCm39) missense probably benign 0.16
IGL02494:Or4n4 APN 14 50,519,683 (GRCm39) missense probably damaging 1.00
IGL02606:Or4n4 APN 14 50,519,530 (GRCm39) missense probably damaging 1.00
IGL02799:Or4n4 UTSW 14 50,518,801 (GRCm39) missense probably benign
PIT4142001:Or4n4 UTSW 14 50,518,784 (GRCm39) makesense probably null
R0570:Or4n4 UTSW 14 50,519,370 (GRCm39) missense probably benign 0.00
R1570:Or4n4 UTSW 14 50,518,981 (GRCm39) missense probably damaging 1.00
R1860:Or4n4 UTSW 14 50,518,848 (GRCm39) nonsense probably null
R2313:Or4n4 UTSW 14 50,519,431 (GRCm39) missense probably damaging 1.00
R4594:Or4n4 UTSW 14 50,519,140 (GRCm39) missense probably benign 0.02
R6442:Or4n4 UTSW 14 50,518,826 (GRCm39) missense probably damaging 0.98
R6783:Or4n4 UTSW 14 50,519,644 (GRCm39) missense probably benign
R7334:Or4n4 UTSW 14 50,519,036 (GRCm39) missense probably benign 0.08
R7763:Or4n4 UTSW 14 50,518,945 (GRCm39) missense probably damaging 1.00
R8207:Or4n4 UTSW 14 50,519,036 (GRCm39) missense probably benign 0.02
R8228:Or4n4 UTSW 14 50,518,997 (GRCm39) missense probably damaging 1.00
R8806:Or4n4 UTSW 14 50,519,236 (GRCm39) missense probably benign 0.04
R8809:Or4n4 UTSW 14 50,519,236 (GRCm39) missense probably benign 0.04
R8898:Or4n4 UTSW 14 50,518,952 (GRCm39) missense probably damaging 1.00
R9800:Or4n4 UTSW 14 50,519,701 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CACTCATACATCTGATAAGTTTTGCTC -3'
(R):5'- TTCACAGGTCAGCTTCTGAAGG -3'

Sequencing Primer
(F):5'- AGAGCTCTGTTATTCCTTTTTGAAGC -3'
(R):5'- AGCTATATCTACATGTACCACTCATG -3'
Posted On 2021-08-31