Incidental Mutation 'R8962:Dock5'
ID 682428
Institutional Source Beutler Lab
Gene Symbol Dock5
Ensembl Gene ENSMUSG00000044447
Gene Name dedicator of cytokinesis 5
Synonyms lr2, 1110060D06Rik, rlc
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock # R8962 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 67752135-67933442 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 67757191 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1807 (T1807A)
Ref Sequence ENSEMBL: ENSMUSP00000036674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039135]
AlphaFold B2RY04
Predicted Effect probably benign
Transcript: ENSMUST00000039135
AA Change: T1807A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036674
Gene: ENSMUSG00000044447
AA Change: T1807A

DomainStartEndE-ValueType
SH3 11 68 1.45e-13 SMART
Pfam:DOCK_N 71 434 9e-110 PFAM
Pfam:DOCK-C2 439 636 1.1e-57 PFAM
low complexity region 752 764 N/A INTRINSIC
Pfam:DHR-2 1133 1635 6.4e-99 PFAM
low complexity region 1663 1692 N/A INTRINSIC
low complexity region 1815 1824 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family act as guanine nucleotide exchange factors for small Rho family G proteins. The protein encoded by this gene is thought to associate with adaptors CRK and CRKL, and function in regulation of intestinal epithelial cell spreading and migration on collagen IV. Similar proteins in mouse and zebrafish also function in myoblast fusion. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mutations at this locus result in lens abnormalities involving cataracts and rupturing of the lens nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik T A 9: 46,308,875 M120L probably benign Het
6430573F11Rik A G 8: 36,505,575 K60E probably damaging Het
Abat A G 16: 8,578,302 T48A probably damaging Het
Abca8a A T 11: 110,078,808 I314N probably damaging Het
Abr A T 11: 76,461,329 V108D probably damaging Het
Adamts17 T G 7: 67,075,309 L162V probably damaging Het
Adamts6 A T 13: 104,297,391 K109N probably damaging Het
Ago3 A G 4: 126,347,802 F68S probably damaging Het
Aifm3 T C 16: 17,506,336 probably null Het
Ankrd26 T C 6: 118,535,143 E506G probably benign Het
Apaf1 A G 10: 91,067,204 L185P probably damaging Het
Atp8b3 G T 10: 80,520,062 T1272K probably benign Het
Cars2 A G 8: 11,537,304 V193A probably benign Het
Ccr8 A T 9: 120,094,547 I243F possibly damaging Het
Col12a1 A G 9: 79,631,619 V2465A probably damaging Het
Ctbp1 T C 5: 33,259,272 N127S probably benign Het
Ddx10 A G 9: 53,238,077 S117P probably damaging Het
Dgkb T C 12: 38,139,495 probably null Het
Dnah11 T A 12: 117,952,538 D3520V probably damaging Het
Dnah11 C T 12: 117,954,895 D1530N probably damaging Het
Drd3 C T 16: 43,821,479 T386I probably damaging Het
Dsg1b A G 18: 20,409,259 N941S probably damaging Het
Enpp3 T C 10: 24,820,615 T141A probably benign Het
Esyt1 A T 10: 128,520,697 C360S possibly damaging Het
Ethe1 T A 7: 24,606,257 V143D probably damaging Het
Fam170b A G 14: 32,835,379 D57G probably benign Het
Fam53c T C 18: 34,768,176 S49P probably damaging Het
Fbp1 G A 13: 62,875,253 L77F probably benign Het
Gm10471 T G 5: 26,085,747 E142A probably benign Het
Gm17093 A G 14: 44,520,692 E110G Het
Gm21976 G T 13: 98,287,313 silent Het
Golgb1 T C 16: 36,913,616 I1075T probably damaging Het
Grip2 T C 6: 91,777,410 D628G probably damaging Het
Gtpbp1 G T 15: 79,717,728 L557F probably benign Het
Ighv12-3 A T 12: 114,366,584 F97Y probably benign Het
Itga8 T C 2: 12,191,234 H635R possibly damaging Het
Itgb7 A G 15: 102,218,602 L466S probably damaging Het
Klc2 T C 19: 5,111,836 D277G probably benign Het
Ktn1 A G 14: 47,663,791 E2G probably damaging Het
Lcmt1 T A 7: 123,401,446 Y68N probably damaging Het
March10 G T 11: 105,389,989 S490* probably null Het
Mterf1b A T 5: 4,196,437 Y26F probably benign Het
Myo18b T A 5: 112,858,480 I855F probably benign Het
Nek4 G A 14: 30,953,958 M83I probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nos1 T C 5: 117,879,340 V256A probably benign Het
Nr1h2 T C 7: 44,552,039 T50A probably benign Het
Olfr296-ps1 T A 7: 86,562,109 *126K probably null Het
Olfr732 A C 14: 50,281,359 M298R possibly damaging Het
Ovol2 G C 2: 144,305,914 R172G probably damaging Het
Parp14 A G 16: 35,856,817 I927T probably damaging Het
Pcdhga7 T A 18: 37,715,826 H295Q probably benign Het
Pkhd1l1 C T 15: 44,536,895 T2145I probably damaging Het
Plekhs1 C T 19: 56,473,248 T139I possibly damaging Het
Rab11fip3 T A 17: 26,012,033 D746V probably damaging Het
Rnf214 A C 9: 45,898,430 probably null Het
Rtn4ip1 A T 10: 43,946,419 probably null Het
S1pr1 T C 3: 115,711,920 R342G Het
Serpina1f T C 12: 103,689,872 S366G probably benign Het
Sestd1 A T 2: 77,212,364 M282K probably benign Het
Siglecf T G 7: 43,351,716 V36G probably damaging Het
Slc1a1 T C 19: 28,909,469 V410A probably damaging Het
Slc38a4 C A 15: 97,019,803 D14Y probably benign Het
Slk C T 19: 47,622,309 T806M probably damaging Het
Slurp2 C A 15: 74,743,400 V48F possibly damaging Het
Socs1 A G 16: 10,784,778 S32P possibly damaging Het
Son T C 16: 91,658,169 V1268A possibly damaging Het
Sp7 C A 15: 102,366,445 probably benign Het
Taar7b T G 10: 24,000,461 S175A probably benign Het
Tet2 T C 3: 133,488,043 N210S probably benign Het
Tkfc T C 19: 10,593,336 D492G probably damaging Het
Tmc7 G A 7: 118,561,005 P203L probably benign Het
Tshz2 C A 2: 169,884,604 F373L probably damaging Het
Ttc29 T A 8: 78,315,707 L307Q probably damaging Het
Tubd1 G A 11: 86,548,833 M1I probably null Het
Vmn1r62 T A 7: 5,675,602 M94K probably damaging Het
Vmn2r125 T C 4: 156,350,891 I188T possibly damaging Het
Vmn2r5 T C 3: 64,491,143 D805G probably damaging Het
Vmn2r6 A T 3: 64,556,155 D419E probably damaging Het
Vps39 A T 2: 120,344,206 Y98* probably null Het
Wisp2 C T 2: 163,825,240 R54* probably null Het
Zdbf2 G A 1: 63,308,003 G1847D probably benign Het
Zdhhc6 T C 19: 55,298,807 E407G probably benign Het
Zfp407 A G 18: 84,558,932 I1352T probably damaging Het
Zfp607a A G 7: 27,879,361 K619E possibly damaging Het
Zfp811 A T 17: 32,798,648 N139K probably benign Het
Other mutations in Dock5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Dock5 APN 14 67786889 splice site probably benign
IGL00930:Dock5 APN 14 67771077 missense probably damaging 1.00
IGL01525:Dock5 APN 14 67805720 splice site probably benign
IGL01759:Dock5 APN 14 67881259 nonsense probably null
IGL01941:Dock5 APN 14 67812232 missense probably damaging 1.00
IGL02025:Dock5 APN 14 67763287 missense probably damaging 1.00
IGL02093:Dock5 APN 14 67839543 splice site probably benign
IGL02179:Dock5 APN 14 67806496 splice site probably benign
IGL02208:Dock5 APN 14 67828450 missense probably benign 0.06
IGL02605:Dock5 APN 14 67828438 missense probably benign 0.18
IGL02608:Dock5 APN 14 67828439 missense probably benign 0.01
IGL02938:Dock5 APN 14 67757218 splice site probably benign
IGL02971:Dock5 APN 14 67757109 missense probably null 1.00
IGL02983:Dock5 APN 14 67764670 missense probably damaging 1.00
IGL03151:Dock5 APN 14 67866067 missense probably damaging 1.00
IGL03410:Dock5 APN 14 67846086 missense probably benign 0.04
PIT4366001:Dock5 UTSW 14 67824674 missense possibly damaging 0.83
R0026:Dock5 UTSW 14 67846081 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0112:Dock5 UTSW 14 67819641 missense probably benign
R0127:Dock5 UTSW 14 67846042 missense probably benign 0.13
R0144:Dock5 UTSW 14 67786286 missense probably benign 0.18
R0312:Dock5 UTSW 14 67795991 missense possibly damaging 0.82
R0360:Dock5 UTSW 14 67822680 splice site probably benign
R0364:Dock5 UTSW 14 67822680 splice site probably benign
R0496:Dock5 UTSW 14 67817518 missense probably damaging 1.00
R0506:Dock5 UTSW 14 67784792 splice site probably benign
R0586:Dock5 UTSW 14 67809032 missense probably damaging 1.00
R0597:Dock5 UTSW 14 67784934 splice site probably null
R0625:Dock5 UTSW 14 67841163 missense probably benign
R1109:Dock5 UTSW 14 67806478 missense possibly damaging 0.80
R1221:Dock5 UTSW 14 67759161 missense probably benign 0.00
R1278:Dock5 UTSW 14 67839566 missense possibly damaging 0.80
R1927:Dock5 UTSW 14 67846062 missense possibly damaging 0.60
R1944:Dock5 UTSW 14 67757135 nonsense probably null
R1946:Dock5 UTSW 14 67786316 missense probably damaging 1.00
R2046:Dock5 UTSW 14 67812142 missense probably benign
R2101:Dock5 UTSW 14 67794010 missense probably benign 0.02
R2252:Dock5 UTSW 14 67784812 missense probably damaging 0.98
R2882:Dock5 UTSW 14 67839620 missense probably damaging 0.99
R3110:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R3112:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R4236:Dock5 UTSW 14 67756492 missense probably benign 0.02
R4242:Dock5 UTSW 14 67828490 missense probably benign 0.19
R4244:Dock5 UTSW 14 67774582 missense probably benign 0.41
R4646:Dock5 UTSW 14 67842779 missense probably benign 0.01
R4793:Dock5 UTSW 14 67800354 missense probably benign 0.26
R4841:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R4842:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R5159:Dock5 UTSW 14 67792289 missense probably benign 0.04
R5164:Dock5 UTSW 14 67817661 nonsense probably null
R5206:Dock5 UTSW 14 67763184 missense probably benign 0.35
R5207:Dock5 UTSW 14 67776284 missense probably benign 0.06
R5322:Dock5 UTSW 14 67770266 missense probably benign 0.41
R5374:Dock5 UTSW 14 67805756 missense possibly damaging 0.81
R5413:Dock5 UTSW 14 67764655 missense probably damaging 1.00
R5476:Dock5 UTSW 14 67814007 missense possibly damaging 0.92
R5504:Dock5 UTSW 14 67803086 missense probably benign 0.01
R5677:Dock5 UTSW 14 67777603 missense probably benign 0.00
R5773:Dock5 UTSW 14 67796058 missense possibly damaging 0.95
R5845:Dock5 UTSW 14 67841101 missense possibly damaging 0.82
R5957:Dock5 UTSW 14 67857994 missense probably benign
R6154:Dock5 UTSW 14 67859912 missense probably benign 0.03
R6268:Dock5 UTSW 14 67790275 nonsense probably null
R6393:Dock5 UTSW 14 67822602 missense probably benign 0.32
R6512:Dock5 UTSW 14 67824648 missense possibly damaging 0.93
R6759:Dock5 UTSW 14 67795996 missense probably benign 0.00
R7012:Dock5 UTSW 14 67822586 missense probably damaging 1.00
R7061:Dock5 UTSW 14 67770254 missense probably damaging 0.96
R7196:Dock5 UTSW 14 67756470 missense probably damaging 1.00
R7200:Dock5 UTSW 14 67771702 nonsense probably null
R7311:Dock5 UTSW 14 67828502 missense probably benign 0.25
R7359:Dock5 UTSW 14 67765888 missense probably benign 0.10
R7422:Dock5 UTSW 14 67809030 missense probably benign 0.01
R7588:Dock5 UTSW 14 67763158 critical splice donor site probably null
R7637:Dock5 UTSW 14 67786340 missense possibly damaging 0.95
R7709:Dock5 UTSW 14 67796005 missense probably benign 0.44
R7763:Dock5 UTSW 14 67821327 missense probably damaging 0.97
R8044:Dock5 UTSW 14 67824692 missense probably damaging 1.00
R8076:Dock5 UTSW 14 67802977 splice site probably null
R8168:Dock5 UTSW 14 67770197 splice site probably null
R8353:Dock5 UTSW 14 67817508 splice site probably null
R8480:Dock5 UTSW 14 67836410 missense probably benign 0.32
R8535:Dock5 UTSW 14 67793976 missense probably benign 0.19
R8708:Dock5 UTSW 14 67767371 missense probably benign 0.02
R8732:Dock5 UTSW 14 67846000 missense possibly damaging 0.85
R8888:Dock5 UTSW 14 67817663 missense possibly damaging 0.95
R8895:Dock5 UTSW 14 67817663 missense possibly damaging 0.95
R8936:Dock5 UTSW 14 67845990 nonsense probably null
R8972:Dock5 UTSW 14 67776300 missense probably damaging 1.00
R9244:Dock5 UTSW 14 67759114 missense probably damaging 0.99
R9345:Dock5 UTSW 14 67822622 missense possibly damaging 0.74
R9679:Dock5 UTSW 14 67781001 missense probably damaging 1.00
X0023:Dock5 UTSW 14 67771088 missense probably benign 0.15
Z1177:Dock5 UTSW 14 67813933 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTCTGAAGCAAACCAGGCAC -3'
(R):5'- TGTTCATGTGGGTACAAGATCCTC -3'

Sequencing Primer
(F):5'- GGCACTGACTTTATAGTGCCACATG -3'
(R):5'- ATGTGGGTACAAGATCCTCTCCATTC -3'
Posted On 2021-08-31