Mutagenetix > Incidental Mutation

Incidental Mutation 'R8962:Gtpbp1'

682431

Institutional Source

Beutler Lab

Gene Symbol

Gtpbp1

Ensembl Gene

ENSMUSG00000042535

Gene Name

GTP binding protein 1

Synonyms

GP-1, GTPBP1

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8962 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

79690845-79721479 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 79717728 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 557 (L557F)

Ref Sequence

ENSEMBL: ENSMUSP00000043575 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046463] [ENSMUST00000231095]

AlphaFold

O08582

PDB Structure

Murine Alloreactive ScFv TCR-Peptide-MHC Class I Molecule Complex [X-RAY DIFFRACTION]
Mhc Class I H-2Kb molecule complexed with pKB1 peptide [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000046463
AA Change: L557F

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000043575
Gene: ENSMUSG00000042535
AA Change: L557F

Domain	Start	End	E-Value	Type
low complexity region	28	37	N/A	INTRINSIC
Pfam:GTP_EFTU	160	385	2.7e-24	PFAM
low complexity region	402	420	N/A	INTRINSIC
SCOP:d1exma2	491	575	4e-19	SMART
low complexity region	605	619	N/A	INTRINSIC
low complexity region	645	653	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000231095

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.4%

Validation Efficiency

99% (86/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is upregulated by interferon-gamma and encodes a protein that is a member of the AGP11/GTPBP1 family of GTP-binding proteins. A structurally similar protein has been found in mouse, where disruption of the gene for that protein had no observable phenotype. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice for a targeted null mutation were viable and fertile with no obvious morphological or behavioral defects. In addition, no defects in macrophage function were observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931429L15Rik	T	A	9: 46,308,875	M120L	probably benign	Het
6430573F11Rik	A	G	8: 36,505,575	K60E	probably damaging	Het
Abat	A	G	16: 8,578,302	T48A	probably damaging	Het
Abca8a	A	T	11: 110,078,808	I314N	probably damaging	Het
Abr	A	T	11: 76,461,329	V108D	probably damaging	Het
Adamts17	T	G	7: 67,075,309	L162V	probably damaging	Het
Adamts6	A	T	13: 104,297,391	K109N	probably damaging	Het
Ago3	A	G	4: 126,347,802	F68S	probably damaging	Het
Aifm3	T	C	16: 17,506,336		probably null	Het
Ankrd26	T	C	6: 118,535,143	E506G	probably benign	Het
Apaf1	A	G	10: 91,067,204	L185P	probably damaging	Het
Atp8b3	G	T	10: 80,520,062	T1272K	probably benign	Het
Cars2	A	G	8: 11,537,304	V193A	probably benign	Het
Ccr8	A	T	9: 120,094,547	I243F	possibly damaging	Het
Col12a1	A	G	9: 79,631,619	V2465A	probably damaging	Het
Ctbp1	T	C	5: 33,259,272	N127S	probably benign	Het
Ddx10	A	G	9: 53,238,077	S117P	probably damaging	Het
Dgkb	T	C	12: 38,139,495		probably null	Het
Dnah11	T	A	12: 117,952,538	D3520V	probably damaging	Het
Dnah11	C	T	12: 117,954,895	D1530N	probably damaging	Het
Dock5	T	C	14: 67,757,191	T1807A	probably benign	Het
Drd3	C	T	16: 43,821,479	T386I	probably damaging	Het
Dsg1b	A	G	18: 20,409,259	N941S	probably damaging	Het
Enpp3	T	C	10: 24,820,615	T141A	probably benign	Het
Esyt1	A	T	10: 128,520,697	C360S	possibly damaging	Het
Ethe1	T	A	7: 24,606,257	V143D	probably damaging	Het
Fam170b	A	G	14: 32,835,379	D57G	probably benign	Het
Fam53c	T	C	18: 34,768,176	S49P	probably damaging	Het
Fbp1	G	A	13: 62,875,253	L77F	probably benign	Het
Gm10471	T	G	5: 26,085,747	E142A	probably benign	Het
Gm17093	A	G	14: 44,520,692	E110G		Het
Gm21976	G	T	13: 98,287,313		silent	Het
Golgb1	T	C	16: 36,913,616	I1075T	probably damaging	Het
Grip2	T	C	6: 91,777,410	D628G	probably damaging	Het
Ighv12-3	A	T	12: 114,366,584	F97Y	probably benign	Het
Itga8	T	C	2: 12,191,234	H635R	possibly damaging	Het
Itgb7	A	G	15: 102,218,602	L466S	probably damaging	Het
Klc2	T	C	19: 5,111,836	D277G	probably benign	Het
Ktn1	A	G	14: 47,663,791	E2G	probably damaging	Het
Lcmt1	T	A	7: 123,401,446	Y68N	probably damaging	Het
March10	G	T	11: 105,389,989	S490*	probably null	Het
Mterf1b	A	T	5: 4,196,437	Y26F	probably benign	Het
Myo18b	T	A	5: 112,858,480	I855F	probably benign	Het
Nek4	G	A	14: 30,953,958	M83I	probably damaging	Het
Nicn1	C	T	9: 108,294,509	R163C	possibly damaging	Het
Nos1	T	C	5: 117,879,340	V256A	probably benign	Het
Nr1h2	T	C	7: 44,552,039	T50A	probably benign	Het
Olfr296-ps1	T	A	7: 86,562,109	*126K	probably null	Het
Olfr732	A	C	14: 50,281,359	M298R	possibly damaging	Het
Ovol2	G	C	2: 144,305,914	R172G	probably damaging	Het
Parp14	A	G	16: 35,856,817	I927T	probably damaging	Het
Pcdhga7	T	A	18: 37,715,826	H295Q	probably benign	Het
Pkhd1l1	C	T	15: 44,536,895	T2145I	probably damaging	Het
Plekhs1	C	T	19: 56,473,248	T139I	possibly damaging	Het
Rab11fip3	T	A	17: 26,012,033	D746V	probably damaging	Het
Rnf214	A	C	9: 45,898,430		probably null	Het
Rtn4ip1	A	T	10: 43,946,419		probably null	Het
S1pr1	T	C	3: 115,711,920	R342G		Het
Serpina1f	T	C	12: 103,689,872	S366G	probably benign	Het
Sestd1	A	T	2: 77,212,364	M282K	probably benign	Het
Siglecf	T	G	7: 43,351,716	V36G	probably damaging	Het
Slc1a1	T	C	19: 28,909,469	V410A	probably damaging	Het
Slc38a4	C	A	15: 97,019,803	D14Y	probably benign	Het
Slk	C	T	19: 47,622,309	T806M	probably damaging	Het
Slurp2	C	A	15: 74,743,400	V48F	possibly damaging	Het
Socs1	A	G	16: 10,784,778	S32P	possibly damaging	Het
Son	T	C	16: 91,658,169	V1268A	possibly damaging	Het
Sp7	C	A	15: 102,366,445		probably benign	Het
Taar7b	T	G	10: 24,000,461	S175A	probably benign	Het
Tet2	T	C	3: 133,488,043	N210S	probably benign	Het
Tkfc	T	C	19: 10,593,336	D492G	probably damaging	Het
Tmc7	G	A	7: 118,561,005	P203L	probably benign	Het
Tshz2	C	A	2: 169,884,604	F373L	probably damaging	Het
Ttc29	T	A	8: 78,315,707	L307Q	probably damaging	Het
Tubd1	G	A	11: 86,548,833	M1I	probably null	Het
Vmn1r62	T	A	7: 5,675,602	M94K	probably damaging	Het
Vmn2r125	T	C	4: 156,350,891	I188T	possibly damaging	Het
Vmn2r5	T	C	3: 64,491,143	D805G	probably damaging	Het
Vmn2r6	A	T	3: 64,556,155	D419E	probably damaging	Het
Vps39	A	T	2: 120,344,206	Y98*	probably null	Het
Wisp2	C	T	2: 163,825,240	R54*	probably null	Het
Zdbf2	G	A	1: 63,308,003	G1847D	probably benign	Het
Zdhhc6	T	C	19: 55,298,807	E407G	probably benign	Het
Zfp407	A	G	18: 84,558,932	I1352T	probably damaging	Het
Zfp607a	A	G	7: 27,879,361	K619E	possibly damaging	Het
Zfp811	A	T	17: 32,798,648	N139K	probably benign	Het

Other mutations in Gtpbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Gtpbp1	APN	15	79719136	missense	possibly damaging	0.90
IGL01783:Gtpbp1	APN	15	79716197	missense	probably damaging	1.00
IGL01794:Gtpbp1	APN	15	79716246	missense	probably damaging	1.00
IGL01859:Gtpbp1	APN	15	79719140	missense	probably benign
IGL02245:Gtpbp1	APN	15	79690926	missense	probably benign	0.02
IGL02532:Gtpbp1	APN	15	79720077	missense	probably benign	0.05
IGL02730:Gtpbp1	APN	15	79719171	missense	probably benign
IGL02796:Gtpbp1	UTSW	15	79716985	missense	possibly damaging	0.83
R0525:Gtpbp1	UTSW	15	79713447	missense	probably benign	0.09
R0531:Gtpbp1	UTSW	15	79720091	missense	probably damaging	1.00
R0535:Gtpbp1	UTSW	15	79707732	missense	probably damaging	1.00
R0665:Gtpbp1	UTSW	15	79713447	missense	probably benign	0.09
R0760:Gtpbp1	UTSW	15	79719155	missense	probably damaging	0.99
R0799:Gtpbp1	UTSW	15	79716200	missense	probably damaging	1.00
R1445:Gtpbp1	UTSW	15	79713448	missense	possibly damaging	0.82
R1458:Gtpbp1	UTSW	15	79707729	missense	probably damaging	1.00
R1462:Gtpbp1	UTSW	15	79707885	missense	probably damaging	1.00
R1462:Gtpbp1	UTSW	15	79707885	missense	probably damaging	1.00
R1498:Gtpbp1	UTSW	15	79719021	splice site	probably null
R1567:Gtpbp1	UTSW	15	79712190	missense	probably damaging	0.98
R3028:Gtpbp1	UTSW	15	79715879	missense	possibly damaging	0.64
R4431:Gtpbp1	UTSW	15	79716197	missense	probably damaging	1.00
R4583:Gtpbp1	UTSW	15	79715951	missense	possibly damaging	0.64
R4854:Gtpbp1	UTSW	15	79719205	missense	probably benign
R4925:Gtpbp1	UTSW	15	79715968	missense	probably benign	0.23
R5023:Gtpbp1	UTSW	15	79719221	missense	possibly damaging	0.49
R5052:Gtpbp1	UTSW	15	79715969	missense	probably damaging	1.00
R5695:Gtpbp1	UTSW	15	79712174	splice site	probably null
R6009:Gtpbp1	UTSW	15	79712096	missense	probably damaging	1.00
R6089:Gtpbp1	UTSW	15	79706997	missense	probably benign	0.15
R7088:Gtpbp1	UTSW	15	79719282	missense
R7343:Gtpbp1	UTSW	15	79691042	missense	probably benign	0.03
R7383:Gtpbp1	UTSW	15	79716153	missense	probably damaging	1.00
R8747:Gtpbp1	UTSW	15	79719281	missense
R8863:Gtpbp1	UTSW	15	79707061	missense	possibly damaging	0.51
R8914:Gtpbp1	UTSW	15	79716192	missense	probably damaging	1.00
R9150:Gtpbp1	UTSW	15	79707964	missense	probably damaging	1.00
R9269:Gtpbp1	UTSW	15	79717654	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGGTCTCACATGTCCTGACC -3'
(R):5'- GGCTACCCCATAATACCTTGGTG -3'

Sequencing Primer
(F):5'- GACCCTGGTTCTCTTGGCAG -3'
(R):5'- CCATAATACCTTGGTGATAGCCGG -3'

Posted On

2021-08-31