Incidental Mutation 'R8962:Socs1'
ID 682436
Institutional Source Beutler Lab
Gene Symbol Socs1
Ensembl Gene ENSMUSG00000038037
Gene Name suppressor of cytokine signaling 1
Synonyms Cish1, JAB, JAK-binding protein, SOCS-1, STAT-induced STAT inhibitor 1, Cish7, SSI-1, JAK2-binding protein
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8962 (G1)
Quality Score 185.009
Status Validated
Chromosome 16
Chromosomal Location 10782240-10785536 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 10784778 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 32 (S32P)
Ref Sequence ENSEMBL: ENSMUSP00000155530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038099] [ENSMUST00000051297] [ENSMUST00000229866]
AlphaFold O35716
Predicted Effect possibly damaging
Transcript: ENSMUST00000038099
AA Change: S32P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000038121
Gene: ENSMUSG00000038037
AA Change: S32P

DomainStartEndE-ValueType
low complexity region 14 51 N/A INTRINSIC
SH2 78 161 1.29e-21 SMART
SOCS 166 209 2.48e-14 SMART
SOCS_box 172 208 9.01e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000051297
SMART Domains Protein: ENSMUSP00000053078
Gene: ENSMUSG00000043050

DomainStartEndE-ValueType
Pfam:TP2 1 117 4.1e-40 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000229866
AA Change: S32P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the STAT-induced STAT inhibitor (SSI), also known as suppressor of cytokine signaling (SOCS), family. SSI family members are cytokine-inducible negative regulators of cytokine signaling. The expression of this gene can be induced by a subset of cytokines, including IL2, IL3 erythropoietin (EPO), CSF2/GM-CSF, and interferon (IFN)-gamma. The protein encoded by this gene functions downstream of cytokine receptors, and takes part in a negative feedback loop to attenuate cytokine signaling. Knockout studies in mice suggested the role of this gene as a modulator of IFN-gamma action, which is required for normal postnatal growth and survival. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit retarded growth, hyperresponsiveness to endogenous interferon gamma, hepatitis with fatty degeneration, lymphopenia due to excess apoptosis, monocytic organ infiltration, and lethality by 3 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik T A 9: 46,308,875 M120L probably benign Het
6430573F11Rik A G 8: 36,505,575 K60E probably damaging Het
Abat A G 16: 8,578,302 T48A probably damaging Het
Abca8a A T 11: 110,078,808 I314N probably damaging Het
Abr A T 11: 76,461,329 V108D probably damaging Het
Adamts17 T G 7: 67,075,309 L162V probably damaging Het
Adamts6 A T 13: 104,297,391 K109N probably damaging Het
Ago3 A G 4: 126,347,802 F68S probably damaging Het
Aifm3 T C 16: 17,506,336 probably null Het
Ankrd26 T C 6: 118,535,143 E506G probably benign Het
Apaf1 A G 10: 91,067,204 L185P probably damaging Het
Atp8b3 G T 10: 80,520,062 T1272K probably benign Het
Cars2 A G 8: 11,537,304 V193A probably benign Het
Ccr8 A T 9: 120,094,547 I243F possibly damaging Het
Col12a1 A G 9: 79,631,619 V2465A probably damaging Het
Ctbp1 T C 5: 33,259,272 N127S probably benign Het
Ddx10 A G 9: 53,238,077 S117P probably damaging Het
Dgkb T C 12: 38,139,495 probably null Het
Dnah11 T A 12: 117,952,538 D3520V probably damaging Het
Dnah11 C T 12: 117,954,895 D1530N probably damaging Het
Dock5 T C 14: 67,757,191 T1807A probably benign Het
Drd3 C T 16: 43,821,479 T386I probably damaging Het
Dsg1b A G 18: 20,409,259 N941S probably damaging Het
Enpp3 T C 10: 24,820,615 T141A probably benign Het
Esyt1 A T 10: 128,520,697 C360S possibly damaging Het
Ethe1 T A 7: 24,606,257 V143D probably damaging Het
Fam170b A G 14: 32,835,379 D57G probably benign Het
Fam53c T C 18: 34,768,176 S49P probably damaging Het
Fbp1 G A 13: 62,875,253 L77F probably benign Het
Gm10471 T G 5: 26,085,747 E142A probably benign Het
Gm17093 A G 14: 44,520,692 E110G Het
Gm21976 G T 13: 98,287,313 silent Het
Golgb1 T C 16: 36,913,616 I1075T probably damaging Het
Grip2 T C 6: 91,777,410 D628G probably damaging Het
Gtpbp1 G T 15: 79,717,728 L557F probably benign Het
Ighv12-3 A T 12: 114,366,584 F97Y probably benign Het
Itga8 T C 2: 12,191,234 H635R possibly damaging Het
Itgb7 A G 15: 102,218,602 L466S probably damaging Het
Klc2 T C 19: 5,111,836 D277G probably benign Het
Ktn1 A G 14: 47,663,791 E2G probably damaging Het
Lcmt1 T A 7: 123,401,446 Y68N probably damaging Het
March10 G T 11: 105,389,989 S490* probably null Het
Mterf1b A T 5: 4,196,437 Y26F probably benign Het
Myo18b T A 5: 112,858,480 I855F probably benign Het
Nek4 G A 14: 30,953,958 M83I probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nos1 T C 5: 117,879,340 V256A probably benign Het
Nr1h2 T C 7: 44,552,039 T50A probably benign Het
Olfr296-ps1 T A 7: 86,562,109 *126K probably null Het
Olfr732 A C 14: 50,281,359 M298R possibly damaging Het
Ovol2 G C 2: 144,305,914 R172G probably damaging Het
Parp14 A G 16: 35,856,817 I927T probably damaging Het
Pcdhga7 T A 18: 37,715,826 H295Q probably benign Het
Pkhd1l1 C T 15: 44,536,895 T2145I probably damaging Het
Plekhs1 C T 19: 56,473,248 T139I possibly damaging Het
Rab11fip3 T A 17: 26,012,033 D746V probably damaging Het
Rnf214 A C 9: 45,898,430 probably null Het
Rtn4ip1 A T 10: 43,946,419 probably null Het
S1pr1 T C 3: 115,711,920 R342G Het
Serpina1f T C 12: 103,689,872 S366G probably benign Het
Sestd1 A T 2: 77,212,364 M282K probably benign Het
Siglecf T G 7: 43,351,716 V36G probably damaging Het
Slc1a1 T C 19: 28,909,469 V410A probably damaging Het
Slc38a4 C A 15: 97,019,803 D14Y probably benign Het
Slk C T 19: 47,622,309 T806M probably damaging Het
Slurp2 C A 15: 74,743,400 V48F possibly damaging Het
Son T C 16: 91,658,169 V1268A possibly damaging Het
Sp7 C A 15: 102,366,445 probably benign Het
Taar7b T G 10: 24,000,461 S175A probably benign Het
Tet2 T C 3: 133,488,043 N210S probably benign Het
Tkfc T C 19: 10,593,336 D492G probably damaging Het
Tmc7 G A 7: 118,561,005 P203L probably benign Het
Tshz2 C A 2: 169,884,604 F373L probably damaging Het
Ttc29 T A 8: 78,315,707 L307Q probably damaging Het
Tubd1 G A 11: 86,548,833 M1I probably null Het
Vmn1r62 T A 7: 5,675,602 M94K probably damaging Het
Vmn2r125 T C 4: 156,350,891 I188T possibly damaging Het
Vmn2r5 T C 3: 64,491,143 D805G probably damaging Het
Vmn2r6 A T 3: 64,556,155 D419E probably damaging Het
Vps39 A T 2: 120,344,206 Y98* probably null Het
Wisp2 C T 2: 163,825,240 R54* probably null Het
Zdbf2 G A 1: 63,308,003 G1847D probably benign Het
Zdhhc6 T C 19: 55,298,807 E407G probably benign Het
Zfp407 A G 18: 84,558,932 I1352T probably damaging Het
Zfp607a A G 7: 27,879,361 K619E possibly damaging Het
Zfp811 A T 17: 32,798,648 N139K probably benign Het
Other mutations in Socs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03002:Socs1 APN 16 10784540 missense probably damaging 0.98
minipad UTSW 16 10784530 missense probably damaging 1.00
Yogi UTSW 16 10784714 missense possibly damaging 0.92
R0670:Socs1 UTSW 16 10784262 missense probably damaging 1.00
R3027:Socs1 UTSW 16 10784714 missense possibly damaging 0.92
R4509:Socs1 UTSW 16 10784354 missense probably benign 0.10
R4993:Socs1 UTSW 16 10784685 missense probably benign 0.17
R6014:Socs1 UTSW 16 10784493 missense possibly damaging 0.66
R6059:Socs1 UTSW 16 10784530 missense probably damaging 1.00
R6802:Socs1 UTSW 16 10784358 missense probably benign 0.06
R6897:Socs1 UTSW 16 10784402 missense probably benign 0.05
R9058:Socs1 UTSW 16 10784828 missense probably benign
R9299:Socs1 UTSW 16 10784714 missense possibly damaging 0.92
R9337:Socs1 UTSW 16 10784714 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GAAGAAGCAGTTCCGTTGGC -3'
(R):5'- TACTTCGCAGATGAGCCCAC -3'

Sequencing Primer
(F):5'- TGTCGCGCACCAAGAAG -3'
(R):5'- ACCGAGGCTCAAGCTCC -3'
Posted On 2021-08-31