Incidental Mutation 'R8962:Drd3'
ID 682440
Institutional Source Beutler Lab
Gene Symbol Drd3
Ensembl Gene ENSMUSG00000022705
Gene Name dopamine receptor D3
Synonyms D3 receptor, D3R
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.283) question?
Stock # R8962 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 43754026-43822932 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 43821479 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 386 (T386I)
Ref Sequence ENSEMBL: ENSMUSP00000155033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023390] [ENSMUST00000229953]
AlphaFold P30728
Predicted Effect probably damaging
Transcript: ENSMUST00000023390
AA Change: T354I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023390
Gene: ENSMUSG00000022705
AA Change: T354I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 40 234 4.5e-9 PFAM
Pfam:7tm_1 46 429 5.9e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229953
AA Change: T386I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.3044 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the D3 subtype of the five (D1-D5) dopamine receptors. The activity of the D3 subtype receptor is mediated by G proteins which inhibit adenylyl cyclase. This receptor is localized to the limbic areas of the brain, which are associated with cognitive, emotional, and endocrine functions. Genetic variation in this gene may be associated with susceptibility to hereditary essential tremor 1. Alternative splicing of this gene results in transcript variants encoding different isoforms, although some variants may be subject to nonsense-mediated decay (NMD). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show exploratory hyperactivity and increased locomotion and rearing behavior, with heterozygous mice displaying similar, but less pronounced, behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik T A 9: 46,308,875 M120L probably benign Het
6430573F11Rik A G 8: 36,505,575 K60E probably damaging Het
Abat A G 16: 8,578,302 T48A probably damaging Het
Abca8a A T 11: 110,078,808 I314N probably damaging Het
Abr A T 11: 76,461,329 V108D probably damaging Het
Adamts17 T G 7: 67,075,309 L162V probably damaging Het
Adamts6 A T 13: 104,297,391 K109N probably damaging Het
Ago3 A G 4: 126,347,802 F68S probably damaging Het
Aifm3 T C 16: 17,506,336 probably null Het
Ankrd26 T C 6: 118,535,143 E506G probably benign Het
Apaf1 A G 10: 91,067,204 L185P probably damaging Het
Atp8b3 G T 10: 80,520,062 T1272K probably benign Het
Cars2 A G 8: 11,537,304 V193A probably benign Het
Ccr8 A T 9: 120,094,547 I243F possibly damaging Het
Col12a1 A G 9: 79,631,619 V2465A probably damaging Het
Ctbp1 T C 5: 33,259,272 N127S probably benign Het
Ddx10 A G 9: 53,238,077 S117P probably damaging Het
Dgkb T C 12: 38,139,495 probably null Het
Dnah11 T A 12: 117,952,538 D3520V probably damaging Het
Dnah11 C T 12: 117,954,895 D1530N probably damaging Het
Dock5 T C 14: 67,757,191 T1807A probably benign Het
Dsg1b A G 18: 20,409,259 N941S probably damaging Het
Enpp3 T C 10: 24,820,615 T141A probably benign Het
Esyt1 A T 10: 128,520,697 C360S possibly damaging Het
Ethe1 T A 7: 24,606,257 V143D probably damaging Het
Fam170b A G 14: 32,835,379 D57G probably benign Het
Fam53c T C 18: 34,768,176 S49P probably damaging Het
Fbp1 G A 13: 62,875,253 L77F probably benign Het
Gm10471 T G 5: 26,085,747 E142A probably benign Het
Gm17093 A G 14: 44,520,692 E110G Het
Gm21976 G T 13: 98,287,313 silent Het
Golgb1 T C 16: 36,913,616 I1075T probably damaging Het
Grip2 T C 6: 91,777,410 D628G probably damaging Het
Gtpbp1 G T 15: 79,717,728 L557F probably benign Het
Ighv12-3 A T 12: 114,366,584 F97Y probably benign Het
Itga8 T C 2: 12,191,234 H635R possibly damaging Het
Itgb7 A G 15: 102,218,602 L466S probably damaging Het
Klc2 T C 19: 5,111,836 D277G probably benign Het
Ktn1 A G 14: 47,663,791 E2G probably damaging Het
Lcmt1 T A 7: 123,401,446 Y68N probably damaging Het
March10 G T 11: 105,389,989 S490* probably null Het
Mterf1b A T 5: 4,196,437 Y26F probably benign Het
Myo18b T A 5: 112,858,480 I855F probably benign Het
Nek4 G A 14: 30,953,958 M83I probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nos1 T C 5: 117,879,340 V256A probably benign Het
Nr1h2 T C 7: 44,552,039 T50A probably benign Het
Olfr296-ps1 T A 7: 86,562,109 *126K probably null Het
Olfr732 A C 14: 50,281,359 M298R possibly damaging Het
Ovol2 G C 2: 144,305,914 R172G probably damaging Het
Parp14 A G 16: 35,856,817 I927T probably damaging Het
Pcdhga7 T A 18: 37,715,826 H295Q probably benign Het
Pkhd1l1 C T 15: 44,536,895 T2145I probably damaging Het
Plekhs1 C T 19: 56,473,248 T139I possibly damaging Het
Rab11fip3 T A 17: 26,012,033 D746V probably damaging Het
Rnf214 A C 9: 45,898,430 probably null Het
Rtn4ip1 A T 10: 43,946,419 probably null Het
S1pr1 T C 3: 115,711,920 R342G Het
Serpina1f T C 12: 103,689,872 S366G probably benign Het
Sestd1 A T 2: 77,212,364 M282K probably benign Het
Siglecf T G 7: 43,351,716 V36G probably damaging Het
Slc1a1 T C 19: 28,909,469 V410A probably damaging Het
Slc38a4 C A 15: 97,019,803 D14Y probably benign Het
Slk C T 19: 47,622,309 T806M probably damaging Het
Slurp2 C A 15: 74,743,400 V48F possibly damaging Het
Socs1 A G 16: 10,784,778 S32P possibly damaging Het
Son T C 16: 91,658,169 V1268A possibly damaging Het
Sp7 C A 15: 102,366,445 probably benign Het
Taar7b T G 10: 24,000,461 S175A probably benign Het
Tet2 T C 3: 133,488,043 N210S probably benign Het
Tkfc T C 19: 10,593,336 D492G probably damaging Het
Tmc7 G A 7: 118,561,005 P203L probably benign Het
Tshz2 C A 2: 169,884,604 F373L probably damaging Het
Ttc29 T A 8: 78,315,707 L307Q probably damaging Het
Tubd1 G A 11: 86,548,833 M1I probably null Het
Vmn1r62 T A 7: 5,675,602 M94K probably damaging Het
Vmn2r125 T C 4: 156,350,891 I188T possibly damaging Het
Vmn2r5 T C 3: 64,491,143 D805G probably damaging Het
Vmn2r6 A T 3: 64,556,155 D419E probably damaging Het
Vps39 A T 2: 120,344,206 Y98* probably null Het
Wisp2 C T 2: 163,825,240 R54* probably null Het
Zdbf2 G A 1: 63,308,003 G1847D probably benign Het
Zdhhc6 T C 19: 55,298,807 E407G probably benign Het
Zfp407 A G 18: 84,558,932 I1352T probably damaging Het
Zfp607a A G 7: 27,879,361 K619E possibly damaging Het
Zfp811 A T 17: 32,798,648 N139K probably benign Het
Other mutations in Drd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Drd3 APN 16 43762321 missense probably benign 0.01
IGL01715:Drd3 APN 16 43821268 missense probably damaging 0.98
IGL01944:Drd3 APN 16 43818308 missense probably benign 0.16
IGL02212:Drd3 APN 16 43762312 missense probably benign 0.21
IGL02666:Drd3 APN 16 43816956 splice site probably benign
R0529:Drd3 UTSW 16 43822714 missense probably damaging 1.00
R1102:Drd3 UTSW 16 43762483 missense probably damaging 1.00
R1310:Drd3 UTSW 16 43821529 missense probably damaging 0.96
R1548:Drd3 UTSW 16 43821341 missense probably benign 0.01
R3124:Drd3 UTSW 16 43822792 missense probably damaging 1.00
R3753:Drd3 UTSW 16 43817103 missense probably damaging 1.00
R4363:Drd3 UTSW 16 43762359 missense probably damaging 1.00
R4724:Drd3 UTSW 16 43822801 nonsense probably null
R4725:Drd3 UTSW 16 43822801 nonsense probably null
R4726:Drd3 UTSW 16 43822801 nonsense probably null
R5016:Drd3 UTSW 16 43762246 missense possibly damaging 0.88
R5850:Drd3 UTSW 16 43818332 missense probably benign 0.00
R6052:Drd3 UTSW 16 43821283 missense probably benign 0.01
R6377:Drd3 UTSW 16 43821307 nonsense probably null
R6888:Drd3 UTSW 16 43817139 missense probably benign 0.22
R6928:Drd3 UTSW 16 43821320 missense probably benign 0.16
R7031:Drd3 UTSW 16 43762498 missense probably damaging 0.98
R7089:Drd3 UTSW 16 43807378 missense probably damaging 1.00
R7447:Drd3 UTSW 16 43817063 nonsense probably null
R7567:Drd3 UTSW 16 43822684 missense probably benign 0.00
R7575:Drd3 UTSW 16 43817133 missense probably benign 0.11
R7772:Drd3 UTSW 16 43762395 missense probably benign 0.05
R8694:Drd3 UTSW 16 43822712 missense probably damaging 1.00
R9536:Drd3 UTSW 16 43817005 missense probably damaging 0.98
R9632:Drd3 UTSW 16 43822772 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATGCCAGGACCCTCTCTTG -3'
(R):5'- TTGCCAATGTTCTTTAAAGGTGGC -3'

Sequencing Primer
(F):5'- TCTCCTGGCCAGACACATG -3'
(R):5'- GGTGGCTATAATAACCCAAATTGCAG -3'
Posted On 2021-08-31