Incidental Mutation 'R8962:Rab11fip3'
ID 682442
Institutional Source Beutler Lab
Gene Symbol Rab11fip3
Ensembl Gene ENSMUSG00000037098
Gene Name RAB11 family interacting protein 3 (class II)
Synonyms D030060O14Rik, Rab11-FIP3
MMRRC Submission 068796-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8962 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 26208010-26288529 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 26231007 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 746 (D746V)
Ref Sequence ENSEMBL: ENSMUSP00000113521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118828] [ENSMUST00000120691] [ENSMUST00000122103] [ENSMUST00000148021]
AlphaFold Q8CHD8
Predicted Effect probably benign
Transcript: ENSMUST00000118828
SMART Domains Protein: ENSMUSP00000113048
Gene: ENSMUSG00000037098

DomainStartEndE-ValueType
low complexity region 136 148 N/A INTRINSIC
low complexity region 313 333 N/A INTRINSIC
Blast:BRLZ 335 385 2e-11 BLAST
Pfam:RBD-FIP 404 444 2.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120691
SMART Domains Protein: ENSMUSP00000112875
Gene: ENSMUSG00000037098

DomainStartEndE-ValueType
internal_repeat_1 29 130 3.12e-31 PROSPERO
internal_repeat_1 144 294 3.12e-31 PROSPERO
EFh 500 528 3.03e-1 SMART
EFh 532 560 3.86e1 SMART
low complexity region 739 751 N/A INTRINSIC
low complexity region 916 936 N/A INTRINSIC
Blast:BRLZ 938 988 2e-11 BLAST
Pfam:RBD-FIP 1007 1047 4.7e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122103
AA Change: D746V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113521
Gene: ENSMUSG00000037098
AA Change: D746V

DomainStartEndE-ValueType
internal_repeat_1 29 130 2.03e-32 PROSPERO
internal_repeat_1 144 294 2.03e-32 PROSPERO
EFh 500 528 3.03e-1 SMART
EFh 532 560 3.86e1 SMART
low complexity region 784 796 N/A INTRINSIC
low complexity region 961 981 N/A INTRINSIC
Blast:BRLZ 983 1033 2e-11 BLAST
Pfam:RBD-FIP 1052 1092 4.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148021
Meta Mutation Damage Score 0.2341 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the large Rab GTPase family (see RAB1A; MIM 179508) have regulatory roles in the formation, targeting, and fusion of intracellular transport vesicles. RAB11FIP3 is one of many proteins that interact with and regulate Rab GTPases (Hales et al., 2001 [PubMed 11495908]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik T A 9: 46,220,173 (GRCm39) M120L probably benign Het
Abat A G 16: 8,396,166 (GRCm39) T48A probably damaging Het
Abca8a A T 11: 109,969,634 (GRCm39) I314N probably damaging Het
Abr A T 11: 76,352,155 (GRCm39) V108D probably damaging Het
Adamts17 T G 7: 66,725,057 (GRCm39) L162V probably damaging Het
Adamts6 A T 13: 104,433,899 (GRCm39) K109N probably damaging Het
Ago3 A G 4: 126,241,595 (GRCm39) F68S probably damaging Het
Aifm3 T C 16: 17,324,200 (GRCm39) probably null Het
Ankrd26 T C 6: 118,512,104 (GRCm39) E506G probably benign Het
Apaf1 A G 10: 90,903,066 (GRCm39) L185P probably damaging Het
Atp8b3 G T 10: 80,355,896 (GRCm39) T1272K probably benign Het
Cars2 A G 8: 11,587,304 (GRCm39) V193A probably benign Het
Ccn5 C T 2: 163,667,160 (GRCm39) R54* probably null Het
Ccr8 A T 9: 119,923,613 (GRCm39) I243F possibly damaging Het
Col12a1 A G 9: 79,538,901 (GRCm39) V2465A probably damaging Het
Ctbp1 T C 5: 33,416,616 (GRCm39) N127S probably benign Het
Ddx10 A G 9: 53,149,377 (GRCm39) S117P probably damaging Het
Dgkb T C 12: 38,189,494 (GRCm39) probably null Het
Dnah11 T A 12: 117,916,273 (GRCm39) D3520V probably damaging Het
Dnah11 C T 12: 117,918,630 (GRCm39) D1530N probably damaging Het
Dock5 T C 14: 67,994,640 (GRCm39) T1807A probably benign Het
Drd3 C T 16: 43,641,842 (GRCm39) T386I probably damaging Het
Dsg1b A G 18: 20,542,316 (GRCm39) N941S probably damaging Het
Enpp3 T C 10: 24,696,513 (GRCm39) T141A probably benign Het
Esyt1 A T 10: 128,356,566 (GRCm39) C360S possibly damaging Het
Ethe1 T A 7: 24,305,682 (GRCm39) V143D probably damaging Het
Fam170b A G 14: 32,557,336 (GRCm39) D57G probably benign Het
Fam53c T C 18: 34,901,229 (GRCm39) S49P probably damaging Het
Fbp1 G A 13: 63,023,067 (GRCm39) L77F probably benign Het
Gm17093 A G 14: 44,758,149 (GRCm39) E110G Het
Gm21976 G T 13: 98,423,821 (GRCm39) silent Het
Golgb1 T C 16: 36,733,978 (GRCm39) I1075T probably damaging Het
Grip2 T C 6: 91,754,391 (GRCm39) D628G probably damaging Het
Gtpbp1 G T 15: 79,601,929 (GRCm39) L557F probably benign Het
Ighv12-3 A T 12: 114,330,204 (GRCm39) F97Y probably benign Het
Itga8 T C 2: 12,196,045 (GRCm39) H635R possibly damaging Het
Itgb7 A G 15: 102,127,037 (GRCm39) L466S probably damaging Het
Klc2 T C 19: 5,161,864 (GRCm39) D277G probably benign Het
Ktn1 A G 14: 47,901,248 (GRCm39) E2G probably damaging Het
Lcmt1 T A 7: 123,000,669 (GRCm39) Y68N probably damaging Het
Marchf10 G T 11: 105,280,815 (GRCm39) S490* probably null Het
Mterf1b A T 5: 4,246,437 (GRCm39) Y26F probably benign Het
Myo18b T A 5: 113,006,346 (GRCm39) I855F probably benign Het
Nek4 G A 14: 30,675,915 (GRCm39) M83I probably damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nos1 T C 5: 118,017,405 (GRCm39) V256A probably benign Het
Nr1h2 T C 7: 44,201,463 (GRCm39) T50A probably benign Het
Or14c42-ps1 T A 7: 86,211,317 (GRCm39) *126K probably null Het
Or4n4 A C 14: 50,518,816 (GRCm39) M298R possibly damaging Het
Ovol2 G C 2: 144,147,834 (GRCm39) R172G probably damaging Het
Parp14 A G 16: 35,677,187 (GRCm39) I927T probably damaging Het
Pcdhga7 T A 18: 37,848,879 (GRCm39) H295Q probably benign Het
Pkhd1l1 C T 15: 44,400,291 (GRCm39) T2145I probably damaging Het
Plekhs1 C T 19: 56,461,680 (GRCm39) T139I possibly damaging Het
Rnf214 A C 9: 45,809,728 (GRCm39) probably null Het
Rtn4ip1 A T 10: 43,822,415 (GRCm39) probably null Het
S1pr1 T C 3: 115,505,569 (GRCm39) R342G Het
Serpina1f T C 12: 103,656,131 (GRCm39) S366G probably benign Het
Sestd1 A T 2: 77,042,708 (GRCm39) M282K probably benign Het
Siglecf T G 7: 43,001,140 (GRCm39) V36G probably damaging Het
Slc1a1 T C 19: 28,886,869 (GRCm39) V410A probably damaging Het
Slc38a4 C A 15: 96,917,684 (GRCm39) D14Y probably benign Het
Slk C T 19: 47,610,748 (GRCm39) T806M probably damaging Het
Slurp2 C A 15: 74,615,249 (GRCm39) V48F possibly damaging Het
Socs1 A G 16: 10,602,642 (GRCm39) S32P possibly damaging Het
Son T C 16: 91,455,057 (GRCm39) V1268A possibly damaging Het
Sp7 C A 15: 102,274,880 (GRCm39) probably benign Het
Speer4a2 T G 5: 26,290,745 (GRCm39) E142A probably benign Het
Taar7b T G 10: 23,876,359 (GRCm39) S175A probably benign Het
Tet2 T C 3: 133,193,804 (GRCm39) N210S probably benign Het
Tkfc T C 19: 10,570,700 (GRCm39) D492G probably damaging Het
Tmc7 G A 7: 118,160,228 (GRCm39) P203L probably benign Het
Trmt9b A G 8: 36,972,729 (GRCm39) K60E probably damaging Het
Tshz2 C A 2: 169,726,524 (GRCm39) F373L probably damaging Het
Ttc29 T A 8: 79,042,336 (GRCm39) L307Q probably damaging Het
Tubd1 G A 11: 86,439,659 (GRCm39) M1I probably null Het
Vmn1r62 T A 7: 5,678,601 (GRCm39) M94K probably damaging Het
Vmn2r125 T C 4: 156,703,186 (GRCm39) I188T possibly damaging Het
Vmn2r5 T C 3: 64,398,564 (GRCm39) D805G probably damaging Het
Vmn2r6 A T 3: 64,463,576 (GRCm39) D419E probably damaging Het
Vps39 A T 2: 120,174,687 (GRCm39) Y98* probably null Het
Zdbf2 G A 1: 63,347,162 (GRCm39) G1847D probably benign Het
Zdhhc6 T C 19: 55,287,239 (GRCm39) E407G probably benign Het
Zfp407 A G 18: 84,577,057 (GRCm39) I1352T probably damaging Het
Zfp607a A G 7: 27,578,786 (GRCm39) K619E possibly damaging Het
Zfp811 A T 17: 33,017,622 (GRCm39) N139K probably benign Het
Other mutations in Rab11fip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Rab11fip3 APN 17 26,210,783 (GRCm39) splice site probably benign
IGL00420:Rab11fip3 APN 17 26,286,599 (GRCm39) missense probably benign 0.20
IGL01291:Rab11fip3 APN 17 26,235,087 (GRCm39) missense probably damaging 0.99
IGL01473:Rab11fip3 APN 17 26,287,709 (GRCm39) missense possibly damaging 0.53
IGL01687:Rab11fip3 APN 17 26,286,956 (GRCm39) missense probably damaging 0.97
IGL01764:Rab11fip3 APN 17 26,287,667 (GRCm39) missense probably benign 0.02
IGL01977:Rab11fip3 APN 17 26,286,977 (GRCm39) missense possibly damaging 0.72
IGL02140:Rab11fip3 APN 17 26,286,866 (GRCm39) missense probably benign 0.33
IGL02434:Rab11fip3 APN 17 26,287,809 (GRCm39) missense possibly damaging 0.85
IGL02549:Rab11fip3 APN 17 26,213,294 (GRCm39) missense probably damaging 0.96
IGL02889:Rab11fip3 APN 17 26,286,653 (GRCm39) missense possibly damaging 0.84
IGL02953:Rab11fip3 APN 17 26,286,653 (GRCm39) missense possibly damaging 0.84
ANU05:Rab11fip3 UTSW 17 26,235,087 (GRCm39) missense probably damaging 0.99
R0193:Rab11fip3 UTSW 17 26,209,973 (GRCm39) missense probably damaging 0.99
R0388:Rab11fip3 UTSW 17 26,288,046 (GRCm39) missense probably benign 0.33
R0543:Rab11fip3 UTSW 17 26,213,199 (GRCm39) missense probably damaging 1.00
R0678:Rab11fip3 UTSW 17 26,287,821 (GRCm39) missense probably benign 0.00
R1283:Rab11fip3 UTSW 17 26,223,528 (GRCm39) missense probably damaging 1.00
R1473:Rab11fip3 UTSW 17 26,210,296 (GRCm39) missense probably damaging 1.00
R1625:Rab11fip3 UTSW 17 26,287,865 (GRCm39) missense possibly damaging 0.72
R1973:Rab11fip3 UTSW 17 26,243,365 (GRCm39) missense probably damaging 0.97
R2160:Rab11fip3 UTSW 17 26,288,028 (GRCm39) missense probably benign 0.33
R2197:Rab11fip3 UTSW 17 26,287,152 (GRCm39) missense probably benign
R2382:Rab11fip3 UTSW 17 26,209,841 (GRCm39) nonsense probably null
R3028:Rab11fip3 UTSW 17 26,234,916 (GRCm39) critical splice donor site probably null
R3797:Rab11fip3 UTSW 17 26,287,500 (GRCm39) missense possibly damaging 0.73
R4012:Rab11fip3 UTSW 17 26,287,002 (GRCm39) frame shift probably null
R4064:Rab11fip3 UTSW 17 26,243,368 (GRCm39) missense probably damaging 0.97
R4478:Rab11fip3 UTSW 17 26,235,057 (GRCm39) missense probably damaging 1.00
R4527:Rab11fip3 UTSW 17 26,255,631 (GRCm39) missense probably damaging 1.00
R4565:Rab11fip3 UTSW 17 26,287,680 (GRCm39) missense possibly damaging 0.73
R5048:Rab11fip3 UTSW 17 26,286,554 (GRCm39) critical splice donor site probably null
R5138:Rab11fip3 UTSW 17 26,210,000 (GRCm39) missense probably benign 0.32
R5317:Rab11fip3 UTSW 17 26,287,052 (GRCm39) missense possibly damaging 0.72
R5453:Rab11fip3 UTSW 17 26,211,555 (GRCm39) critical splice donor site probably null
R5495:Rab11fip3 UTSW 17 26,235,117 (GRCm39) missense probably damaging 0.99
R5525:Rab11fip3 UTSW 17 26,210,269 (GRCm39) missense probably damaging 1.00
R5654:Rab11fip3 UTSW 17 26,235,038 (GRCm39) missense probably damaging 1.00
R5716:Rab11fip3 UTSW 17 26,255,638 (GRCm39) missense probably damaging 1.00
R5818:Rab11fip3 UTSW 17 26,235,090 (GRCm39) missense probably damaging 1.00
R6044:Rab11fip3 UTSW 17 26,286,843 (GRCm39) missense possibly damaging 0.93
R6716:Rab11fip3 UTSW 17 26,210,031 (GRCm39) missense probably damaging 1.00
R6785:Rab11fip3 UTSW 17 26,210,692 (GRCm39) missense probably damaging 0.99
R7161:Rab11fip3 UTSW 17 26,288,064 (GRCm39) missense probably benign 0.09
R7390:Rab11fip3 UTSW 17 26,287,126 (GRCm39) missense possibly damaging 0.81
R7447:Rab11fip3 UTSW 17 26,287,848 (GRCm39) missense possibly damaging 0.66
R7836:Rab11fip3 UTSW 17 26,287,232 (GRCm39) missense possibly damaging 0.82
R7981:Rab11fip3 UTSW 17 26,216,963 (GRCm39) missense probably damaging 0.98
R8008:Rab11fip3 UTSW 17 26,286,956 (GRCm39) missense probably damaging 0.97
R8887:Rab11fip3 UTSW 17 26,286,927 (GRCm39) missense possibly damaging 0.83
R9250:Rab11fip3 UTSW 17 26,237,219 (GRCm39) missense unknown
R9329:Rab11fip3 UTSW 17 26,231,032 (GRCm39) missense probably benign 0.15
R9506:Rab11fip3 UTSW 17 26,213,250 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGCGAGATCAAGGCATGC -3'
(R):5'- TCTGACTTGTGCAGTTAACACC -3'

Sequencing Primer
(F):5'- GCATGCAGGGACAGCTG -3'
(R):5'- GACTTGTGCAGTTAACACCTCCTC -3'
Posted On 2021-08-31