Incidental Mutation 'R0735:Edil3'
ID68245
Institutional Source Beutler Lab
Gene Symbol Edil3
Ensembl Gene ENSMUSG00000034488
Gene NameEGF-like repeats and discoidin I-like domains 3
SynonymsDel-1, developmental endothelial locus-1, Del1
MMRRC Submission 038916-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0735 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location88821472-89323223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 89177178 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 219 (V219F)
Ref Sequence ENSEMBL: ENSMUSP00000044652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043111] [ENSMUST00000081769] [ENSMUST00000118731]
Predicted Effect probably damaging
Transcript: ENSMUST00000043111
AA Change: V219F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000044652
Gene: ENSMUSG00000034488
AA Change: V219F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 60 2.03e-6 SMART
EGF 67 107 1.62e-5 SMART
EGF_CA 109 145 4.32e-10 SMART
FA58C 147 304 3.7e-58 SMART
FA58C 308 466 1.44e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081769
AA Change: V229F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080462
Gene: ENSMUSG00000034488
AA Change: V229F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 60 2.03e-6 SMART
EGF 77 117 1.62e-5 SMART
EGF_CA 119 155 4.32e-10 SMART
FA58C 157 314 3.7e-58 SMART
FA58C 318 476 1.44e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118731
AA Change: V229F

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112829
Gene: ENSMUSG00000034488
AA Change: V229F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 60 2.03e-6 SMART
EGF 77 117 1.62e-5 SMART
EGF_CA 119 155 4.32e-10 SMART
FA58C 157 314 3.7e-58 SMART
SCOP:d1d7pm_ 316 380 4e-20 SMART
Blast:FA58C 319 380 2e-9 BLAST
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.7%
  • 20x: 91.8%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integrin ligand. It plays an important role in mediating angiogenesis and may be important in vessel wall remodeling and development. It also influences endothelial cell behavior. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no noticeable fur phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,717,638 I1552K possibly damaging Het
Actr8 T A 14: 29,989,712 M405K probably benign Het
Adam10 G A 9: 70,748,251 V334I possibly damaging Het
Adgra2 G T 8: 27,117,318 G686C probably damaging Het
Akap11 A T 14: 78,510,078 I1623N probably damaging Het
Astn1 A T 1: 158,472,389 T100S possibly damaging Het
B3galt1 A C 2: 68,118,579 I213L possibly damaging Het
B4galnt4 A G 7: 141,064,323 K101E probably benign Het
Camsap2 A G 1: 136,292,888 S324P probably damaging Het
Chrnb4 A G 9: 55,043,800 S60P probably damaging Het
Cpne1 A G 2: 156,078,750 probably null Het
Cubn G A 2: 13,491,689 probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cxcl15 T C 5: 90,801,294 M106T probably benign Het
Cyp2c23 A T 19: 44,016,810 M140K probably damaging Het
Dgke A G 11: 89,060,075 F104S probably benign Het
Dhx36 T A 3: 62,472,729 M849L probably benign Het
Dnah7a C T 1: 53,544,511 E1522K possibly damaging Het
Egln1 A G 8: 124,948,495 V187A possibly damaging Het
Fam193a T C 5: 34,439,378 I455T possibly damaging Het
Fdft1 A T 14: 63,163,420 I88N probably damaging Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Frs2 T A 10: 117,074,582 S292C probably damaging Het
Gm15448 T C 7: 3,821,782 T533A possibly damaging Het
Gpr107 T A 2: 31,171,994 F145I probably benign Het
Gpr153 T A 4: 152,279,373 C83* probably null Het
H2-Q7 T G 17: 35,440,186 probably null Het
Hsp90b1 A T 10: 86,695,748 probably benign Het
Kcnk1 C A 8: 126,025,289 N211K probably damaging Het
Klb T C 5: 65,379,727 V800A probably benign Het
Lat2 T C 5: 134,606,783 Y59C probably damaging Het
Mlkl A T 8: 111,327,801 probably benign Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mtbp T A 15: 55,562,942 C93* probably null Het
Myo7a A G 7: 98,081,180 probably benign Het
Myt1 G A 2: 181,807,387 probably benign Het
Ogfrl1 T C 1: 23,375,754 Q224R possibly damaging Het
Olfr418 A G 1: 173,271,002 T276A probably benign Het
Olfr661 A T 7: 104,688,819 H268L probably damaging Het
Osbpl2 A G 2: 180,150,290 probably benign Het
Plb1 C T 5: 32,284,920 T252M possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbsn T C 6: 92,189,693 T657A probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rps6kb2 C A 19: 4,157,883 S348I probably benign Het
Rsrp1 C T 4: 134,924,257 R111W unknown Het
Ryr3 T C 2: 112,732,982 T2933A probably benign Het
Scara5 A G 14: 65,731,019 D247G possibly damaging Het
Slc7a11 C T 3: 50,424,096 S231N probably benign Het
Sod2 A T 17: 13,010,564 N91Y probably damaging Het
Spesp1 A T 9: 62,272,685 S314T probably benign Het
St3gal1 C A 15: 67,113,687 M39I probably benign Het
Stat6 A T 10: 127,658,241 I646F probably damaging Het
Tdrd1 A T 19: 56,865,978 K1119* probably null Het
Thbs2 A G 17: 14,679,815 I600T probably benign Het
Tor1a A G 2: 30,963,838 V160A probably damaging Het
Trdmt1 T G 2: 13,523,438 D104A probably benign Het
Trim58 T C 11: 58,651,393 V393A probably benign Het
Trip4 C T 9: 65,884,918 probably benign Het
Trip6 T C 5: 137,310,821 E341G probably benign Het
Ttn T A 2: 76,715,195 I32595F probably damaging Het
Ubr4 T A 4: 139,428,028 probably null Het
Ush2a G A 1: 188,864,693 V3877I probably benign Het
Vmn1r29 G T 6: 58,307,732 G146C probably damaging Het
Vmn2r53 A G 7: 12,581,780 V704A probably benign Het
Vmn2r7 C T 3: 64,716,367 M268I probably benign Het
Wnt7b G A 15: 85,537,495 T248M probably damaging Het
Xab2 G A 8: 3,613,649 P394S possibly damaging Het
Zfp663 A G 2: 165,359,075 V13A probably damaging Het
Other mutations in Edil3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Edil3 APN 13 89289533 missense probably benign 0.40
IGL01628:Edil3 APN 13 89319826 utr 3 prime probably benign
IGL02112:Edil3 APN 13 89180255 missense probably damaging 1.00
IGL03123:Edil3 APN 13 89131736 missense probably damaging 1.00
R0402:Edil3 UTSW 13 89199451 splice site probably benign
R0608:Edil3 UTSW 13 89184849 missense probably damaging 1.00
R0675:Edil3 UTSW 13 89177280 missense probably damaging 0.96
R0991:Edil3 UTSW 13 89289506 nonsense probably null
R1507:Edil3 UTSW 13 89131712 missense probably damaging 1.00
R1643:Edil3 UTSW 13 89289576 critical splice donor site probably null
R2008:Edil3 UTSW 13 88944953 splice site probably null
R3703:Edil3 UTSW 13 89177298 missense probably benign 0.01
R4206:Edil3 UTSW 13 89180278 missense probably damaging 1.00
R4258:Edil3 UTSW 13 89177153 missense probably damaging 1.00
R4570:Edil3 UTSW 13 89131897 intron probably benign
R4575:Edil3 UTSW 13 89319731 missense probably damaging 1.00
R4576:Edil3 UTSW 13 89319731 missense probably damaging 1.00
R4654:Edil3 UTSW 13 89289470 missense probably damaging 1.00
R5420:Edil3 UTSW 13 89131772 missense probably damaging 1.00
R5446:Edil3 UTSW 13 89184838 missense possibly damaging 0.65
R5534:Edil3 UTSW 13 89199474 missense probably benign 0.00
R5653:Edil3 UTSW 13 89131812 missense probably damaging 1.00
R5663:Edil3 UTSW 13 89042508 missense probably damaging 0.99
R5664:Edil3 UTSW 13 89319713 missense probably damaging 1.00
R6179:Edil3 UTSW 13 88821989 missense probably benign
R6254:Edil3 UTSW 13 89319729 missense probably damaging 1.00
R6813:Edil3 UTSW 13 89289456 missense probably damaging 1.00
R7138:Edil3 UTSW 13 89131728 missense probably damaging 1.00
R7215:Edil3 UTSW 13 88822050 critical splice donor site probably null
R7295:Edil3 UTSW 13 89131783 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCACTTTGCATAACATGGCCGAAC -3'
(R):5'- TTTGAGAAGCACTTGTAGGAGCACC -3'

Sequencing Primer
(F):5'- TGGCCGAACAAAGACTTTCTG -3'
(R):5'- AAGGCTCAGGTGTCCCTTTATAAC -3'
Posted On2013-09-03