Incidental Mutation 'R8963:Plxnd1'
ID 682486
Institutional Source Beutler Lab
Gene Symbol Plxnd1
Ensembl Gene ENSMUSG00000030123
Gene Name plexin D1
Synonyms b2b553Clo, 6230425C21Rik, b2b1863Clo
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8963 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 115954811-115995005 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 115972545 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Stop codon at position 760 (S760*)
Ref Sequence ENSEMBL: ENSMUSP00000015511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015511]
AlphaFold Q3UH93
Predicted Effect probably null
Transcript: ENSMUST00000015511
AA Change: S760*
SMART Domains Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: S760*

DomainStartEndE-ValueType
signal peptide 1 48 N/A INTRINSIC
Sema 61 531 6.52e-90 SMART
PSI 550 603 6.06e-12 SMART
PSI 703 755 1.06e-2 SMART
Blast:PSI 850 891 9e-20 BLAST
IPT 892 981 4.43e-20 SMART
IPT 982 1068 6.61e-19 SMART
IPT 1070 1149 6.13e-14 SMART
transmembrane domain 1271 1293 N/A INTRINSIC
Pfam:Plexin_cytopl 1345 1888 5e-238 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131590
SMART Domains Protein: ENSMUSP00000115650
Gene: ENSMUSG00000030123

DomainStartEndE-ValueType
Blast:PSI 2 34 1e-13 BLAST
IPT 35 124 4.43e-20 SMART
Blast:IPT 125 177 3e-30 BLAST
Pfam:TIG 180 233 4.6e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T A 5: 9,437,792 N559K probably damaging Het
Aatk T C 11: 120,012,137 T421A probably damaging Het
Adamts12 T C 15: 11,317,357 probably null Het
Adgrv1 A T 13: 81,419,469 V5195E probably benign Het
Adora2b C T 11: 62,249,157 A19V possibly damaging Het
Ankrd28 A G 14: 31,755,741 C115R probably benign Het
Ankrd35 T A 3: 96,679,687 L106* probably null Het
Ankrd44 G A 1: 54,762,379 A263V probably damaging Het
Apol7b T C 15: 77,423,920 K125R possibly damaging Het
BC005561 T C 5: 104,517,786 V58A probably benign Het
Cacna1c A T 6: 118,742,271 L245* probably null Het
Cbll1 A T 12: 31,488,200 H185Q probably damaging Het
Ccdc150 A C 1: 54,272,482 N209T probably benign Het
Ccdc88a T A 11: 29,498,416 N1465K possibly damaging Het
Cfap54 C A 10: 93,028,700 G124* probably null Het
Chml A T 1: 175,687,035 L440H probably damaging Het
Chrnd A T 1: 87,194,881 Q128L probably damaging Het
Clvs2 A T 10: 33,622,681 D84E probably benign Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Cyp2c40 T A 19: 39,767,482 I463F possibly damaging Het
Cyp51 C A 5: 4,086,519 R425L probably damaging Het
Daam1 A G 12: 71,945,244 T279A unknown Het
Ebf2 G T 14: 67,428,105 V571F probably benign Het
Elavl4 A T 4: 110,206,579 I275N probably damaging Het
F11r A G 1: 171,460,937 Q116R probably benign Het
Foxred2 T A 15: 77,945,605 D580V probably benign Het
Gatad1 A C 5: 3,641,544 L4R probably damaging Het
Gcn1l1 T A 5: 115,589,094 M670K probably benign Het
Greb1 A T 12: 16,724,884 F171I probably damaging Het
Grin2b A G 6: 136,044,009 V98A probably damaging Het
Helz2 A T 2: 181,229,614 V2735E probably damaging Het
Hrct1 A T 4: 43,727,564 probably benign Het
Ighv1-11 C T 12: 114,612,244 R117K probably damaging Het
Igkv12-46 A T 6: 69,764,770 S34T probably damaging Het
Il27ra T A 8: 84,041,082 N71Y probably damaging Het
Iqca G T 1: 90,139,927 H201N probably benign Het
Itgb1bp1 C T 12: 21,274,863 R64Q probably damaging Het
Katnb1 T C 8: 95,082,891 L13S probably damaging Het
Kif26b G A 1: 178,916,149 R1270Q probably benign Het
Klhdc2 A T 12: 69,300,291 R77* probably null Het
Klra10 A T 6: 130,272,654 probably null Het
Large1 A T 8: 72,815,984 I704N probably damaging Het
Lrp1b G A 2: 40,998,184 H2241Y probably benign Het
Lrpap1 T A 5: 35,097,657 M212L probably benign Het
Mab21l1 A G 3: 55,782,927 probably benign Het
Map4k4 A T 1: 40,000,580 Q44L probably damaging Het
Map7d1 A G 4: 126,236,682 S412P probably damaging Het
Me1 A T 9: 86,598,791 F354I probably damaging Het
Nlrp1b A G 11: 71,217,832 V281A probably damaging Het
Nrip2 A G 6: 128,408,325 T240A possibly damaging Het
Nsmaf A G 4: 6,428,471 V203A probably damaging Het
Olfr1120 T A 2: 87,357,606 I54K possibly damaging Het
Olfr1284 A T 2: 111,379,300 Q100L probably damaging Het
Olfr229 A G 9: 39,910,199 Y132C probably damaging Het
Olfr722 A T 14: 49,895,052 M250K probably benign Het
P4ha2 T C 11: 54,114,169 F124L probably benign Het
Pcdha9 A T 18: 36,998,697 D273V probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Polr1b A G 2: 129,115,656 T544A probably benign Het
Polr2g T C 19: 8,794,149 D153G probably damaging Het
Pramef8 T C 4: 143,417,659 Y192H probably benign Het
Rad51ap2 A C 12: 11,456,254 E59A possibly damaging Het
Rrm1 A T 7: 102,456,532 Y285F probably benign Het
Ryr3 A G 2: 112,836,670 probably null Het
Scaf4 GGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTG 16: 90,229,857 probably benign Het
Sftpd A G 14: 41,183,044 V30A probably benign Het
Sirt6 A G 10: 81,626,544 V7A probably benign Het
Ska1 C T 18: 74,197,568 V188M probably damaging Het
Skint8 G A 4: 111,937,044 M210I probably benign Het
Slc6a11 A G 6: 114,225,821 probably null Het
Slc6a2 A T 8: 92,989,074 H280L probably benign Het
Sptan1 T C 2: 29,983,732 V208A possibly damaging Het
Taf6l T A 19: 8,774,771 T518S probably benign Het
Tsc22d1 T C 14: 76,418,826 M59T probably benign Het
Unc5cl A G 17: 48,462,333 T282A probably benign Het
Vav3 A G 3: 109,682,913 K260E probably damaging Het
Vmn2r53 A G 7: 12,581,999 V631A probably damaging Het
Zfp938 A T 10: 82,225,453 F444L possibly damaging Het
Other mutations in Plxnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Plxnd1 APN 6 115967972 missense possibly damaging 0.51
IGL01099:Plxnd1 APN 6 115969945 missense probably benign
IGL01323:Plxnd1 APN 6 115966799 missense possibly damaging 0.81
IGL01382:Plxnd1 APN 6 115960527 missense probably damaging 1.00
IGL01786:Plxnd1 APN 6 115959935 missense probably damaging 1.00
IGL02244:Plxnd1 APN 6 115978257 missense probably benign 0.39
IGL02272:Plxnd1 APN 6 115993628 missense probably damaging 1.00
IGL02293:Plxnd1 APN 6 115963913 missense probably damaging 1.00
IGL02465:Plxnd1 APN 6 115955742 makesense probably null
IGL02873:Plxnd1 APN 6 115959976 missense probably damaging 1.00
IGL03209:Plxnd1 APN 6 115962357 missense probably damaging 1.00
Hiss UTSW 6 115969929 missense possibly damaging 0.94
murmer UTSW 6 115968793 missense probably benign 0.00
mutter UTSW 6 115968044 missense probably benign 0.27
rattle UTSW 6 115959794 missense probably damaging 0.96
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0357:Plxnd1 UTSW 6 115969460 missense probably benign 0.00
R0646:Plxnd1 UTSW 6 115958699 splice site probably benign
R0648:Plxnd1 UTSW 6 115994001 missense possibly damaging 0.86
R0718:Plxnd1 UTSW 6 115966638 missense possibly damaging 0.68
R1116:Plxnd1 UTSW 6 115967005 splice site probably null
R1292:Plxnd1 UTSW 6 115962683 unclassified probably benign
R1715:Plxnd1 UTSW 6 115968681 missense probably benign 0.02
R1760:Plxnd1 UTSW 6 115967779 missense possibly damaging 0.95
R1799:Plxnd1 UTSW 6 115994057 missense probably damaging 1.00
R1817:Plxnd1 UTSW 6 115980601 missense possibly damaging 0.83
R1848:Plxnd1 UTSW 6 115966546 missense probably damaging 1.00
R1851:Plxnd1 UTSW 6 115963914 missense probably damaging 1.00
R1864:Plxnd1 UTSW 6 115969441 splice site probably null
R1865:Plxnd1 UTSW 6 115969441 splice site probably null
R1875:Plxnd1 UTSW 6 115978084 splice site probably null
R1899:Plxnd1 UTSW 6 115969363 missense probably benign
R1913:Plxnd1 UTSW 6 115978017 missense possibly damaging 0.50
R1970:Plxnd1 UTSW 6 115962517 missense probably damaging 1.00
R2007:Plxnd1 UTSW 6 115967255 missense probably damaging 1.00
R2134:Plxnd1 UTSW 6 115957548 missense probably damaging 1.00
R2202:Plxnd1 UTSW 6 115962764 missense probably benign 0.45
R2230:Plxnd1 UTSW 6 115964144 missense probably damaging 1.00
R2267:Plxnd1 UTSW 6 115962743 missense probably benign 0.29
R2427:Plxnd1 UTSW 6 115967748 critical splice donor site probably null
R4108:Plxnd1 UTSW 6 115959315 missense probably damaging 1.00
R4233:Plxnd1 UTSW 6 115965953 missense probably benign 0.30
R4280:Plxnd1 UTSW 6 115956094 splice site probably benign
R4280:Plxnd1 UTSW 6 115956095 splice site probably null
R4346:Plxnd1 UTSW 6 115977980 missense probably benign 0.16
R4439:Plxnd1 UTSW 6 115993976 missense probably damaging 0.99
R4572:Plxnd1 UTSW 6 115955756 missense probably damaging 1.00
R4576:Plxnd1 UTSW 6 115968044 missense probably benign 0.27
R4599:Plxnd1 UTSW 6 115994276 missense probably damaging 1.00
R4614:Plxnd1 UTSW 6 115972525 missense possibly damaging 0.83
R4700:Plxnd1 UTSW 6 115958615 missense probably damaging 1.00
R4705:Plxnd1 UTSW 6 115958620 missense probably damaging 1.00
R4806:Plxnd1 UTSW 6 115960855 missense probably damaging 1.00
R4944:Plxnd1 UTSW 6 115955765 missense probably damaging 1.00
R4977:Plxnd1 UTSW 6 115994376 missense probably damaging 1.00
R5069:Plxnd1 UTSW 6 115965901 missense probably damaging 0.98
R5155:Plxnd1 UTSW 6 115958988 critical splice donor site probably null
R5460:Plxnd1 UTSW 6 115957648 missense probably damaging 1.00
R5729:Plxnd1 UTSW 6 115965877 missense probably damaging 1.00
R5909:Plxnd1 UTSW 6 115968688 missense probably benign 0.00
R5992:Plxnd1 UTSW 6 115967787 critical splice acceptor site probably null
R6129:Plxnd1 UTSW 6 115978174 missense probably damaging 1.00
R6254:Plxnd1 UTSW 6 115977960 missense probably benign 0.01
R6273:Plxnd1 UTSW 6 115978492 missense probably damaging 1.00
R6310:Plxnd1 UTSW 6 115976736 missense possibly damaging 0.94
R6732:Plxnd1 UTSW 6 115969929 missense possibly damaging 0.94
R6857:Plxnd1 UTSW 6 115993763 missense probably benign 0.05
R7243:Plxnd1 UTSW 6 115972507 missense probably benign 0.00
R7282:Plxnd1 UTSW 6 115960837 missense probably damaging 1.00
R7632:Plxnd1 UTSW 6 115976639 missense probably benign
R7699:Plxnd1 UTSW 6 115959794 missense probably damaging 0.96
R7915:Plxnd1 UTSW 6 115966918 missense probably benign 0.00
R8090:Plxnd1 UTSW 6 115956617 missense probably damaging 1.00
R8382:Plxnd1 UTSW 6 115972472 missense probably benign
R8507:Plxnd1 UTSW 6 115966905 missense probably damaging 0.97
R8539:Plxnd1 UTSW 6 115962807 missense possibly damaging 0.94
R8548:Plxnd1 UTSW 6 115957597 missense probably damaging 1.00
R9119:Plxnd1 UTSW 6 115955871 splice site probably benign
R9177:Plxnd1 UTSW 6 115966508 missense probably benign 0.00
R9182:Plxnd1 UTSW 6 115993785 missense probably damaging 0.98
R9185:Plxnd1 UTSW 6 115957565 missense probably damaging 1.00
R9226:Plxnd1 UTSW 6 115957563 missense probably damaging 1.00
R9433:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R9449:Plxnd1 UTSW 6 115955769 missense probably damaging 1.00
R9451:Plxnd1 UTSW 6 115963316 missense possibly damaging 0.72
R9599:Plxnd1 UTSW 6 115963313 missense possibly damaging 0.78
R9627:Plxnd1 UTSW 6 115963313 missense possibly damaging 0.78
R9644:Plxnd1 UTSW 6 115963313 missense possibly damaging 0.78
X0024:Plxnd1 UTSW 6 115963310 missense probably benign 0.02
X0026:Plxnd1 UTSW 6 115966784 missense possibly damaging 0.88
Z1088:Plxnd1 UTSW 6 115967510 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTTACACAGCTGGAATGGGG -3'
(R):5'- ACTCTGGGTCTAAGGAGCAGATC -3'

Sequencing Primer
(F):5'- CAGCTGGAATGGGGCTCAG -3'
(R):5'- TCCAGGAGGAAGACTCTGCCTAG -3'
Posted On 2021-08-31