Incidental Mutation 'R8963:Plxnd1'
ID 682486
Institutional Source Beutler Lab
Gene Symbol Plxnd1
Ensembl Gene ENSMUSG00000030123
Gene Name plexin D1
Synonyms 6230425C21Rik, b2b1863Clo, b2b553Clo
MMRRC Submission 068797-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8963 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 115931772-115971966 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 115949506 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Stop codon at position 760 (S760*)
Ref Sequence ENSEMBL: ENSMUSP00000015511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015511]
AlphaFold Q3UH93
Predicted Effect probably null
Transcript: ENSMUST00000015511
AA Change: S760*
SMART Domains Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: S760*

DomainStartEndE-ValueType
signal peptide 1 48 N/A INTRINSIC
Sema 61 531 6.52e-90 SMART
PSI 550 603 6.06e-12 SMART
PSI 703 755 1.06e-2 SMART
Blast:PSI 850 891 9e-20 BLAST
IPT 892 981 4.43e-20 SMART
IPT 982 1068 6.61e-19 SMART
IPT 1070 1149 6.13e-14 SMART
transmembrane domain 1271 1293 N/A INTRINSIC
Pfam:Plexin_cytopl 1345 1888 5e-238 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131590
SMART Domains Protein: ENSMUSP00000115650
Gene: ENSMUSG00000030123

DomainStartEndE-ValueType
Blast:PSI 2 34 1e-13 BLAST
IPT 35 124 4.43e-20 SMART
Blast:IPT 125 177 3e-30 BLAST
Pfam:TIG 180 233 4.6e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk T C 11: 119,902,963 (GRCm39) T421A probably damaging Het
Adamts12 T C 15: 11,317,443 (GRCm39) probably null Het
Adgrv1 A T 13: 81,567,588 (GRCm39) V5195E probably benign Het
Adora2b C T 11: 62,139,983 (GRCm39) A19V possibly damaging Het
Ankrd28 A G 14: 31,477,698 (GRCm39) C115R probably benign Het
Ankrd35 T A 3: 96,587,003 (GRCm39) L106* probably null Het
Ankrd44 G A 1: 54,801,538 (GRCm39) A263V probably damaging Het
Apol7b T C 15: 77,308,120 (GRCm39) K125R possibly damaging Het
Cacna1c A T 6: 118,719,232 (GRCm39) L245* probably null Het
Cbll1 A T 12: 31,538,199 (GRCm39) H185Q probably damaging Het
Ccdc150 A C 1: 54,311,641 (GRCm39) N209T probably benign Het
Ccdc88a T A 11: 29,448,416 (GRCm39) N1465K possibly damaging Het
Cfap54 C A 10: 92,864,562 (GRCm39) G124* probably null Het
Chml A T 1: 175,514,601 (GRCm39) L440H probably damaging Het
Chrnd A T 1: 87,122,603 (GRCm39) Q128L probably damaging Het
Clvs2 A T 10: 33,498,677 (GRCm39) D84E probably benign Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,604,874 (GRCm39) probably benign Het
Cyp2c40 T A 19: 39,755,926 (GRCm39) I463F possibly damaging Het
Cyp51 C A 5: 4,136,519 (GRCm39) R425L probably damaging Het
Daam1 A G 12: 71,992,018 (GRCm39) T279A unknown Het
Ebf2 G T 14: 67,665,554 (GRCm39) V571F probably benign Het
Elapor2 T A 5: 9,487,792 (GRCm39) N559K probably damaging Het
Elavl4 A T 4: 110,063,776 (GRCm39) I275N probably damaging Het
F11r A G 1: 171,288,505 (GRCm39) Q116R probably benign Het
Foxred2 T A 15: 77,829,805 (GRCm39) D580V probably benign Het
Gatad1 A C 5: 3,691,544 (GRCm39) L4R probably damaging Het
Gcn1 T A 5: 115,727,153 (GRCm39) M670K probably benign Het
Greb1 A T 12: 16,774,885 (GRCm39) F171I probably damaging Het
Grin2b A G 6: 136,021,007 (GRCm39) V98A probably damaging Het
Helz2 A T 2: 180,871,407 (GRCm39) V2735E probably damaging Het
Hrct1 A T 4: 43,727,564 (GRCm39) probably benign Het
Ighv1-11 C T 12: 114,575,864 (GRCm39) R117K probably damaging Het
Igkv12-46 A T 6: 69,741,754 (GRCm39) S34T probably damaging Het
Il27ra T A 8: 84,767,711 (GRCm39) N71Y probably damaging Het
Iqca1 G T 1: 90,067,649 (GRCm39) H201N probably benign Het
Itgb1bp1 C T 12: 21,324,864 (GRCm39) R64Q probably damaging Het
Katnb1 T C 8: 95,809,519 (GRCm39) L13S probably damaging Het
Kif26b G A 1: 178,743,714 (GRCm39) R1270Q probably benign Het
Klhdc2 A T 12: 69,347,065 (GRCm39) R77* probably null Het
Klra10 A T 6: 130,249,617 (GRCm39) probably null Het
Large1 A T 8: 73,542,612 (GRCm39) I704N probably damaging Het
Lrp1b G A 2: 40,888,196 (GRCm39) H2241Y probably benign Het
Lrpap1 T A 5: 35,255,001 (GRCm39) M212L probably benign Het
Mab21l1 A G 3: 55,690,348 (GRCm39) probably benign Het
Map4k4 A T 1: 40,039,740 (GRCm39) Q44L probably damaging Het
Map7d1 A G 4: 126,130,475 (GRCm39) S412P probably damaging Het
Me1 A T 9: 86,480,844 (GRCm39) F354I probably damaging Het
Nlrp1b A G 11: 71,108,658 (GRCm39) V281A probably damaging Het
Nrip2 A G 6: 128,385,288 (GRCm39) T240A possibly damaging Het
Nsmaf A G 4: 6,428,471 (GRCm39) V203A probably damaging Het
Or12e8 T A 2: 87,187,950 (GRCm39) I54K possibly damaging Het
Or4g17 A T 2: 111,209,645 (GRCm39) Q100L probably damaging Het
Or4n5 A T 14: 50,132,509 (GRCm39) M250K probably benign Het
Or8g2 A G 9: 39,821,495 (GRCm39) Y132C probably damaging Het
P4ha2 T C 11: 54,004,995 (GRCm39) F124L probably benign Het
Pcdha9 A T 18: 37,131,750 (GRCm39) D273V probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Polr1b A G 2: 128,957,576 (GRCm39) T544A probably benign Het
Polr2g T C 19: 8,771,513 (GRCm39) D153G probably damaging Het
Pramel12 T C 4: 143,144,229 (GRCm39) Y192H probably benign Het
Rad51ap2 A C 12: 11,506,255 (GRCm39) E59A possibly damaging Het
Rrm1 A T 7: 102,105,739 (GRCm39) Y285F probably benign Het
Ryr3 A G 2: 112,667,015 (GRCm39) probably null Het
Scaf4 GGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTG 16: 90,026,745 (GRCm39) probably benign Het
Sftpd A G 14: 40,905,001 (GRCm39) V30A probably benign Het
Sirt6 A G 10: 81,462,378 (GRCm39) V7A probably benign Het
Ska1 C T 18: 74,330,639 (GRCm39) V188M probably damaging Het
Skint8 G A 4: 111,794,241 (GRCm39) M210I probably benign Het
Slc6a11 A G 6: 114,202,782 (GRCm39) probably null Het
Slc6a2 A T 8: 93,715,702 (GRCm39) H280L probably benign Het
Sptan1 T C 2: 29,873,744 (GRCm39) V208A possibly damaging Het
Taf6l T A 19: 8,752,135 (GRCm39) T518S probably benign Het
Thoc2l T C 5: 104,665,652 (GRCm39) V58A probably benign Het
Tsc22d1 T C 14: 76,656,266 (GRCm39) M59T probably benign Het
Unc5cl A G 17: 48,769,361 (GRCm39) T282A probably benign Het
Vav3 A G 3: 109,590,229 (GRCm39) K260E probably damaging Het
Vmn2r53 A G 7: 12,315,926 (GRCm39) V631A probably damaging Het
Zfp938 A T 10: 82,061,287 (GRCm39) F444L possibly damaging Het
Other mutations in Plxnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Plxnd1 APN 6 115,944,933 (GRCm39) missense possibly damaging 0.51
IGL01099:Plxnd1 APN 6 115,946,906 (GRCm39) missense probably benign
IGL01323:Plxnd1 APN 6 115,943,760 (GRCm39) missense possibly damaging 0.81
IGL01382:Plxnd1 APN 6 115,937,488 (GRCm39) missense probably damaging 1.00
IGL01786:Plxnd1 APN 6 115,936,896 (GRCm39) missense probably damaging 1.00
IGL02244:Plxnd1 APN 6 115,955,218 (GRCm39) missense probably benign 0.39
IGL02272:Plxnd1 APN 6 115,970,589 (GRCm39) missense probably damaging 1.00
IGL02293:Plxnd1 APN 6 115,940,874 (GRCm39) missense probably damaging 1.00
IGL02465:Plxnd1 APN 6 115,932,703 (GRCm39) makesense probably null
IGL02873:Plxnd1 APN 6 115,936,937 (GRCm39) missense probably damaging 1.00
IGL03209:Plxnd1 APN 6 115,939,318 (GRCm39) missense probably damaging 1.00
Hiss UTSW 6 115,946,890 (GRCm39) missense possibly damaging 0.94
murmer UTSW 6 115,945,754 (GRCm39) missense probably benign 0.00
mutter UTSW 6 115,945,005 (GRCm39) missense probably benign 0.27
rattle UTSW 6 115,936,755 (GRCm39) missense probably damaging 0.96
R0238:Plxnd1 UTSW 6 115,945,754 (GRCm39) missense probably benign 0.00
R0238:Plxnd1 UTSW 6 115,945,754 (GRCm39) missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115,945,754 (GRCm39) missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115,945,754 (GRCm39) missense probably benign 0.00
R0357:Plxnd1 UTSW 6 115,946,421 (GRCm39) missense probably benign 0.00
R0646:Plxnd1 UTSW 6 115,935,660 (GRCm39) splice site probably benign
R0648:Plxnd1 UTSW 6 115,970,962 (GRCm39) missense possibly damaging 0.86
R0718:Plxnd1 UTSW 6 115,943,599 (GRCm39) missense possibly damaging 0.68
R1116:Plxnd1 UTSW 6 115,943,966 (GRCm39) splice site probably null
R1292:Plxnd1 UTSW 6 115,939,644 (GRCm39) unclassified probably benign
R1715:Plxnd1 UTSW 6 115,945,642 (GRCm39) missense probably benign 0.02
R1760:Plxnd1 UTSW 6 115,944,740 (GRCm39) missense possibly damaging 0.95
R1799:Plxnd1 UTSW 6 115,971,018 (GRCm39) missense probably damaging 1.00
R1817:Plxnd1 UTSW 6 115,957,562 (GRCm39) missense possibly damaging 0.83
R1848:Plxnd1 UTSW 6 115,943,507 (GRCm39) missense probably damaging 1.00
R1851:Plxnd1 UTSW 6 115,940,875 (GRCm39) missense probably damaging 1.00
R1864:Plxnd1 UTSW 6 115,946,402 (GRCm39) splice site probably null
R1865:Plxnd1 UTSW 6 115,946,402 (GRCm39) splice site probably null
R1875:Plxnd1 UTSW 6 115,955,045 (GRCm39) splice site probably null
R1899:Plxnd1 UTSW 6 115,946,324 (GRCm39) missense probably benign
R1913:Plxnd1 UTSW 6 115,954,978 (GRCm39) missense possibly damaging 0.50
R1970:Plxnd1 UTSW 6 115,939,478 (GRCm39) missense probably damaging 1.00
R2007:Plxnd1 UTSW 6 115,944,216 (GRCm39) missense probably damaging 1.00
R2134:Plxnd1 UTSW 6 115,934,509 (GRCm39) missense probably damaging 1.00
R2202:Plxnd1 UTSW 6 115,939,725 (GRCm39) missense probably benign 0.45
R2230:Plxnd1 UTSW 6 115,941,105 (GRCm39) missense probably damaging 1.00
R2267:Plxnd1 UTSW 6 115,939,704 (GRCm39) missense probably benign 0.29
R2427:Plxnd1 UTSW 6 115,944,709 (GRCm39) critical splice donor site probably null
R4108:Plxnd1 UTSW 6 115,936,276 (GRCm39) missense probably damaging 1.00
R4233:Plxnd1 UTSW 6 115,942,914 (GRCm39) missense probably benign 0.30
R4280:Plxnd1 UTSW 6 115,933,056 (GRCm39) splice site probably null
R4280:Plxnd1 UTSW 6 115,933,055 (GRCm39) splice site probably benign
R4346:Plxnd1 UTSW 6 115,954,941 (GRCm39) missense probably benign 0.16
R4439:Plxnd1 UTSW 6 115,970,937 (GRCm39) missense probably damaging 0.99
R4572:Plxnd1 UTSW 6 115,932,717 (GRCm39) missense probably damaging 1.00
R4576:Plxnd1 UTSW 6 115,945,005 (GRCm39) missense probably benign 0.27
R4599:Plxnd1 UTSW 6 115,971,237 (GRCm39) missense probably damaging 1.00
R4614:Plxnd1 UTSW 6 115,949,486 (GRCm39) missense possibly damaging 0.83
R4700:Plxnd1 UTSW 6 115,935,576 (GRCm39) missense probably damaging 1.00
R4705:Plxnd1 UTSW 6 115,935,581 (GRCm39) missense probably damaging 1.00
R4806:Plxnd1 UTSW 6 115,937,816 (GRCm39) missense probably damaging 1.00
R4944:Plxnd1 UTSW 6 115,932,726 (GRCm39) missense probably damaging 1.00
R4977:Plxnd1 UTSW 6 115,971,337 (GRCm39) missense probably damaging 1.00
R5069:Plxnd1 UTSW 6 115,942,862 (GRCm39) missense probably damaging 0.98
R5155:Plxnd1 UTSW 6 115,935,949 (GRCm39) critical splice donor site probably null
R5460:Plxnd1 UTSW 6 115,934,609 (GRCm39) missense probably damaging 1.00
R5729:Plxnd1 UTSW 6 115,942,838 (GRCm39) missense probably damaging 1.00
R5909:Plxnd1 UTSW 6 115,945,649 (GRCm39) missense probably benign 0.00
R5992:Plxnd1 UTSW 6 115,944,748 (GRCm39) critical splice acceptor site probably null
R6129:Plxnd1 UTSW 6 115,955,135 (GRCm39) missense probably damaging 1.00
R6254:Plxnd1 UTSW 6 115,954,921 (GRCm39) missense probably benign 0.01
R6273:Plxnd1 UTSW 6 115,955,453 (GRCm39) missense probably damaging 1.00
R6310:Plxnd1 UTSW 6 115,953,697 (GRCm39) missense possibly damaging 0.94
R6732:Plxnd1 UTSW 6 115,946,890 (GRCm39) missense possibly damaging 0.94
R6857:Plxnd1 UTSW 6 115,970,724 (GRCm39) missense probably benign 0.05
R7243:Plxnd1 UTSW 6 115,949,468 (GRCm39) missense probably benign 0.00
R7282:Plxnd1 UTSW 6 115,937,798 (GRCm39) missense probably damaging 1.00
R7632:Plxnd1 UTSW 6 115,953,600 (GRCm39) missense probably benign
R7699:Plxnd1 UTSW 6 115,936,755 (GRCm39) missense probably damaging 0.96
R7915:Plxnd1 UTSW 6 115,943,879 (GRCm39) missense probably benign 0.00
R8090:Plxnd1 UTSW 6 115,933,578 (GRCm39) missense probably damaging 1.00
R8382:Plxnd1 UTSW 6 115,949,433 (GRCm39) missense probably benign
R8507:Plxnd1 UTSW 6 115,943,866 (GRCm39) missense probably damaging 0.97
R8539:Plxnd1 UTSW 6 115,939,768 (GRCm39) missense possibly damaging 0.94
R8548:Plxnd1 UTSW 6 115,934,558 (GRCm39) missense probably damaging 1.00
R9119:Plxnd1 UTSW 6 115,932,832 (GRCm39) splice site probably benign
R9177:Plxnd1 UTSW 6 115,943,469 (GRCm39) missense probably benign 0.00
R9182:Plxnd1 UTSW 6 115,970,746 (GRCm39) missense probably damaging 0.98
R9185:Plxnd1 UTSW 6 115,934,526 (GRCm39) missense probably damaging 1.00
R9226:Plxnd1 UTSW 6 115,934,524 (GRCm39) missense probably damaging 1.00
R9433:Plxnd1 UTSW 6 115,945,754 (GRCm39) missense probably benign 0.00
R9449:Plxnd1 UTSW 6 115,932,730 (GRCm39) missense probably damaging 1.00
R9451:Plxnd1 UTSW 6 115,940,277 (GRCm39) missense possibly damaging 0.72
R9599:Plxnd1 UTSW 6 115,940,274 (GRCm39) missense possibly damaging 0.78
R9627:Plxnd1 UTSW 6 115,940,274 (GRCm39) missense possibly damaging 0.78
R9644:Plxnd1 UTSW 6 115,940,274 (GRCm39) missense possibly damaging 0.78
R9672:Plxnd1 UTSW 6 115,940,274 (GRCm39) missense possibly damaging 0.78
X0024:Plxnd1 UTSW 6 115,940,271 (GRCm39) missense probably benign 0.02
X0026:Plxnd1 UTSW 6 115,943,745 (GRCm39) missense possibly damaging 0.88
Z1088:Plxnd1 UTSW 6 115,944,471 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTTACACAGCTGGAATGGGG -3'
(R):5'- ACTCTGGGTCTAAGGAGCAGATC -3'

Sequencing Primer
(F):5'- CAGCTGGAATGGGGCTCAG -3'
(R):5'- TCCAGGAGGAAGACTCTGCCTAG -3'
Posted On 2021-08-31