Incidental Mutation 'R8963:Grin2b'
ID 682490
Institutional Source Beutler Lab
Gene Symbol Grin2b
Ensembl Gene ENSMUSG00000030209
Gene Name glutamate receptor, ionotropic, NMDA2B (epsilon 2)
Synonyms GluRepsilon2, GluN2B, NR2B, NMDAR2B, Nmdar2b
MMRRC Submission 068797-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8963 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 135690231-136150509 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 136021007 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 98 (V98A)
Ref Sequence ENSEMBL: ENSMUSP00000142696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905] [ENSMUST00000125905] [ENSMUST00000143943] [ENSMUST00000152012] [ENSMUST00000188999]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000053880
AA Change: V98A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: V98A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 106 306 8.6e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 4.8e-270 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111905
AA Change: V98A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: V98A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 56 307 4.2e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 2.1e-245 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125905
Predicted Effect probably benign
Transcript: ENSMUST00000143943
Predicted Effect probably damaging
Transcript: ENSMUST00000152012
AA Change: V98A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142696
Gene: ENSMUSG00000030209
AA Change: V98A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 66 312 1.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188999
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk T C 11: 119,902,963 (GRCm39) T421A probably damaging Het
Adamts12 T C 15: 11,317,443 (GRCm39) probably null Het
Adgrv1 A T 13: 81,567,588 (GRCm39) V5195E probably benign Het
Adora2b C T 11: 62,139,983 (GRCm39) A19V possibly damaging Het
Ankrd28 A G 14: 31,477,698 (GRCm39) C115R probably benign Het
Ankrd35 T A 3: 96,587,003 (GRCm39) L106* probably null Het
Ankrd44 G A 1: 54,801,538 (GRCm39) A263V probably damaging Het
Apol7b T C 15: 77,308,120 (GRCm39) K125R possibly damaging Het
Cacna1c A T 6: 118,719,232 (GRCm39) L245* probably null Het
Cbll1 A T 12: 31,538,199 (GRCm39) H185Q probably damaging Het
Ccdc150 A C 1: 54,311,641 (GRCm39) N209T probably benign Het
Ccdc88a T A 11: 29,448,416 (GRCm39) N1465K possibly damaging Het
Cfap54 C A 10: 92,864,562 (GRCm39) G124* probably null Het
Chml A T 1: 175,514,601 (GRCm39) L440H probably damaging Het
Chrnd A T 1: 87,122,603 (GRCm39) Q128L probably damaging Het
Clvs2 A T 10: 33,498,677 (GRCm39) D84E probably benign Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,604,874 (GRCm39) probably benign Het
Cyp2c40 T A 19: 39,755,926 (GRCm39) I463F possibly damaging Het
Cyp51 C A 5: 4,136,519 (GRCm39) R425L probably damaging Het
Daam1 A G 12: 71,992,018 (GRCm39) T279A unknown Het
Ebf2 G T 14: 67,665,554 (GRCm39) V571F probably benign Het
Elapor2 T A 5: 9,487,792 (GRCm39) N559K probably damaging Het
Elavl4 A T 4: 110,063,776 (GRCm39) I275N probably damaging Het
F11r A G 1: 171,288,505 (GRCm39) Q116R probably benign Het
Foxred2 T A 15: 77,829,805 (GRCm39) D580V probably benign Het
Gatad1 A C 5: 3,691,544 (GRCm39) L4R probably damaging Het
Gcn1 T A 5: 115,727,153 (GRCm39) M670K probably benign Het
Greb1 A T 12: 16,774,885 (GRCm39) F171I probably damaging Het
Helz2 A T 2: 180,871,407 (GRCm39) V2735E probably damaging Het
Hrct1 A T 4: 43,727,564 (GRCm39) probably benign Het
Ighv1-11 C T 12: 114,575,864 (GRCm39) R117K probably damaging Het
Igkv12-46 A T 6: 69,741,754 (GRCm39) S34T probably damaging Het
Il27ra T A 8: 84,767,711 (GRCm39) N71Y probably damaging Het
Iqca1 G T 1: 90,067,649 (GRCm39) H201N probably benign Het
Itgb1bp1 C T 12: 21,324,864 (GRCm39) R64Q probably damaging Het
Katnb1 T C 8: 95,809,519 (GRCm39) L13S probably damaging Het
Kif26b G A 1: 178,743,714 (GRCm39) R1270Q probably benign Het
Klhdc2 A T 12: 69,347,065 (GRCm39) R77* probably null Het
Klra10 A T 6: 130,249,617 (GRCm39) probably null Het
Large1 A T 8: 73,542,612 (GRCm39) I704N probably damaging Het
Lrp1b G A 2: 40,888,196 (GRCm39) H2241Y probably benign Het
Lrpap1 T A 5: 35,255,001 (GRCm39) M212L probably benign Het
Mab21l1 A G 3: 55,690,348 (GRCm39) probably benign Het
Map4k4 A T 1: 40,039,740 (GRCm39) Q44L probably damaging Het
Map7d1 A G 4: 126,130,475 (GRCm39) S412P probably damaging Het
Me1 A T 9: 86,480,844 (GRCm39) F354I probably damaging Het
Nlrp1b A G 11: 71,108,658 (GRCm39) V281A probably damaging Het
Nrip2 A G 6: 128,385,288 (GRCm39) T240A possibly damaging Het
Nsmaf A G 4: 6,428,471 (GRCm39) V203A probably damaging Het
Or12e8 T A 2: 87,187,950 (GRCm39) I54K possibly damaging Het
Or4g17 A T 2: 111,209,645 (GRCm39) Q100L probably damaging Het
Or4n5 A T 14: 50,132,509 (GRCm39) M250K probably benign Het
Or8g2 A G 9: 39,821,495 (GRCm39) Y132C probably damaging Het
P4ha2 T C 11: 54,004,995 (GRCm39) F124L probably benign Het
Pcdha9 A T 18: 37,131,750 (GRCm39) D273V probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Plxnd1 G T 6: 115,949,506 (GRCm39) S760* probably null Het
Polr1b A G 2: 128,957,576 (GRCm39) T544A probably benign Het
Polr2g T C 19: 8,771,513 (GRCm39) D153G probably damaging Het
Pramel12 T C 4: 143,144,229 (GRCm39) Y192H probably benign Het
Rad51ap2 A C 12: 11,506,255 (GRCm39) E59A possibly damaging Het
Rrm1 A T 7: 102,105,739 (GRCm39) Y285F probably benign Het
Ryr3 A G 2: 112,667,015 (GRCm39) probably null Het
Scaf4 GGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTG 16: 90,026,745 (GRCm39) probably benign Het
Sftpd A G 14: 40,905,001 (GRCm39) V30A probably benign Het
Sirt6 A G 10: 81,462,378 (GRCm39) V7A probably benign Het
Ska1 C T 18: 74,330,639 (GRCm39) V188M probably damaging Het
Skint8 G A 4: 111,794,241 (GRCm39) M210I probably benign Het
Slc6a11 A G 6: 114,202,782 (GRCm39) probably null Het
Slc6a2 A T 8: 93,715,702 (GRCm39) H280L probably benign Het
Sptan1 T C 2: 29,873,744 (GRCm39) V208A possibly damaging Het
Taf6l T A 19: 8,752,135 (GRCm39) T518S probably benign Het
Thoc2l T C 5: 104,665,652 (GRCm39) V58A probably benign Het
Tsc22d1 T C 14: 76,656,266 (GRCm39) M59T probably benign Het
Unc5cl A G 17: 48,769,361 (GRCm39) T282A probably benign Het
Vav3 A G 3: 109,590,229 (GRCm39) K260E probably damaging Het
Vmn2r53 A G 7: 12,315,926 (GRCm39) V631A probably damaging Het
Zfp938 A T 10: 82,061,287 (GRCm39) F444L possibly damaging Het
Other mutations in Grin2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Grin2b APN 6 135,713,329 (GRCm39) missense possibly damaging 0.55
IGL00835:Grin2b APN 6 135,710,568 (GRCm39) missense probably damaging 1.00
IGL01401:Grin2b APN 6 135,713,361 (GRCm39) missense probably damaging 1.00
IGL01523:Grin2b APN 6 136,021,263 (GRCm39) missense probably null 0.99
IGL01719:Grin2b APN 6 135,710,379 (GRCm39) missense probably damaging 0.97
IGL01907:Grin2b APN 6 135,710,738 (GRCm39) missense probably damaging 1.00
IGL01996:Grin2b APN 6 135,709,584 (GRCm39) missense probably damaging 1.00
IGL02309:Grin2b APN 6 135,713,470 (GRCm39) missense probably damaging 1.00
IGL02312:Grin2b APN 6 135,716,088 (GRCm39) missense probably damaging 1.00
IGL02409:Grin2b APN 6 136,020,906 (GRCm39) missense possibly damaging 0.89
IGL02527:Grin2b APN 6 135,900,389 (GRCm39) missense probably damaging 1.00
IGL02535:Grin2b APN 6 135,756,367 (GRCm39) missense possibly damaging 0.70
IGL02570:Grin2b APN 6 135,899,996 (GRCm39) missense probably damaging 1.00
IGL02702:Grin2b APN 6 135,716,130 (GRCm39) missense probably damaging 0.99
IGL03001:Grin2b APN 6 135,716,113 (GRCm39) missense probably damaging 1.00
IGL03274:Grin2b APN 6 135,757,253 (GRCm39) missense possibly damaging 0.90
R0055:Grin2b UTSW 6 135,900,201 (GRCm39) missense probably benign
R0055:Grin2b UTSW 6 135,900,201 (GRCm39) missense probably benign
R0164:Grin2b UTSW 6 135,755,646 (GRCm39) splice site probably benign
R0194:Grin2b UTSW 6 135,756,303 (GRCm39) missense probably damaging 1.00
R0594:Grin2b UTSW 6 135,710,927 (GRCm39) missense probably damaging 1.00
R1434:Grin2b UTSW 6 135,820,193 (GRCm39) missense probably benign 0.04
R1928:Grin2b UTSW 6 136,021,044 (GRCm39) missense probably damaging 1.00
R1942:Grin2b UTSW 6 135,709,730 (GRCm39) missense possibly damaging 0.93
R1996:Grin2b UTSW 6 136,021,209 (GRCm39) missense possibly damaging 0.52
R2002:Grin2b UTSW 6 135,710,243 (GRCm39) missense probably damaging 1.00
R2020:Grin2b UTSW 6 135,710,894 (GRCm39) missense probably benign 0.12
R2103:Grin2b UTSW 6 135,757,138 (GRCm39) missense probably benign 0.02
R2127:Grin2b UTSW 6 135,755,698 (GRCm39) missense probably benign 0.03
R2495:Grin2b UTSW 6 135,710,180 (GRCm39) missense probably damaging 1.00
R2656:Grin2b UTSW 6 135,710,427 (GRCm39) missense probably damaging 1.00
R2847:Grin2b UTSW 6 135,717,951 (GRCm39) missense probably damaging 1.00
R2866:Grin2b UTSW 6 135,710,637 (GRCm39) missense probably damaging 1.00
R2867:Grin2b UTSW 6 135,710,637 (GRCm39) missense probably damaging 1.00
R2867:Grin2b UTSW 6 135,710,637 (GRCm39) missense probably damaging 1.00
R3196:Grin2b UTSW 6 135,709,453 (GRCm39) small deletion probably benign
R3418:Grin2b UTSW 6 135,820,108 (GRCm39) missense probably benign 0.02
R3808:Grin2b UTSW 6 135,900,269 (GRCm39) missense probably damaging 0.99
R4028:Grin2b UTSW 6 135,713,433 (GRCm39) missense probably damaging 1.00
R4602:Grin2b UTSW 6 135,755,739 (GRCm39) missense probably damaging 1.00
R4624:Grin2b UTSW 6 135,710,823 (GRCm39) missense probably damaging 0.99
R4677:Grin2b UTSW 6 135,751,870 (GRCm39) missense probably benign 0.13
R4744:Grin2b UTSW 6 135,755,697 (GRCm39) missense probably damaging 1.00
R5020:Grin2b UTSW 6 135,710,405 (GRCm39) missense probably benign 0.01
R5051:Grin2b UTSW 6 135,756,393 (GRCm39) missense possibly damaging 0.84
R5105:Grin2b UTSW 6 135,709,439 (GRCm39) missense probably benign 0.03
R5125:Grin2b UTSW 6 135,900,297 (GRCm39) missense possibly damaging 0.89
R5146:Grin2b UTSW 6 135,756,340 (GRCm39) missense probably damaging 1.00
R5318:Grin2b UTSW 6 135,710,916 (GRCm39) missense probably damaging 0.99
R5349:Grin2b UTSW 6 136,021,281 (GRCm39) missense possibly damaging 0.93
R5426:Grin2b UTSW 6 135,709,366 (GRCm39) missense probably damaging 1.00
R5438:Grin2b UTSW 6 135,713,304 (GRCm39) missense probably damaging 1.00
R5439:Grin2b UTSW 6 135,713,304 (GRCm39) missense probably damaging 1.00
R5440:Grin2b UTSW 6 135,713,304 (GRCm39) missense probably damaging 1.00
R5530:Grin2b UTSW 6 135,710,721 (GRCm39) missense probably benign 0.00
R5603:Grin2b UTSW 6 135,900,395 (GRCm39) missense probably damaging 1.00
R5657:Grin2b UTSW 6 135,710,085 (GRCm39) missense possibly damaging 0.48
R5788:Grin2b UTSW 6 135,717,962 (GRCm39) missense probably benign 0.24
R5941:Grin2b UTSW 6 135,713,371 (GRCm39) missense probably damaging 0.99
R6057:Grin2b UTSW 6 135,710,942 (GRCm39) missense possibly damaging 0.84
R6137:Grin2b UTSW 6 135,900,456 (GRCm39) missense possibly damaging 0.89
R6216:Grin2b UTSW 6 135,749,397 (GRCm39) missense probably damaging 1.00
R6309:Grin2b UTSW 6 135,710,025 (GRCm39) missense probably benign 0.00
R6316:Grin2b UTSW 6 135,757,277 (GRCm39) missense probably benign 0.00
R6419:Grin2b UTSW 6 135,717,965 (GRCm39) missense probably damaging 1.00
R6551:Grin2b UTSW 6 135,710,342 (GRCm39) missense probably damaging 1.00
R6612:Grin2b UTSW 6 135,717,996 (GRCm39) missense probably damaging 1.00
R6616:Grin2b UTSW 6 135,709,549 (GRCm39) missense probably benign
R6647:Grin2b UTSW 6 135,710,108 (GRCm39) missense probably damaging 1.00
R6806:Grin2b UTSW 6 135,751,826 (GRCm39) missense possibly damaging 0.84
R6976:Grin2b UTSW 6 135,757,198 (GRCm39) missense probably benign
R7033:Grin2b UTSW 6 135,900,036 (GRCm39) missense probably damaging 1.00
R7058:Grin2b UTSW 6 135,757,304 (GRCm39) missense probably damaging 0.97
R7144:Grin2b UTSW 6 135,710,474 (GRCm39) missense possibly damaging 0.50
R7190:Grin2b UTSW 6 135,709,946 (GRCm39) missense possibly damaging 0.46
R7238:Grin2b UTSW 6 135,757,249 (GRCm39) missense probably damaging 0.97
R7453:Grin2b UTSW 6 135,717,947 (GRCm39) missense possibly damaging 0.56
R7553:Grin2b UTSW 6 135,749,394 (GRCm39) missense possibly damaging 0.88
R7585:Grin2b UTSW 6 135,756,301 (GRCm39) missense probably damaging 0.99
R7615:Grin2b UTSW 6 135,900,362 (GRCm39) missense probably damaging 1.00
R7632:Grin2b UTSW 6 135,709,553 (GRCm39) missense probably benign 0.02
R7779:Grin2b UTSW 6 135,755,792 (GRCm39) nonsense probably null
R8058:Grin2b UTSW 6 135,710,225 (GRCm39) missense probably damaging 1.00
R8084:Grin2b UTSW 6 135,710,486 (GRCm39) missense probably benign 0.03
R8145:Grin2b UTSW 6 135,709,497 (GRCm39) missense probably benign 0.01
R8308:Grin2b UTSW 6 135,900,074 (GRCm39) missense probably damaging 0.99
R8357:Grin2b UTSW 6 135,709,197 (GRCm39) missense probably benign 0.00
R8379:Grin2b UTSW 6 135,899,967 (GRCm39) missense probably damaging 1.00
R8429:Grin2b UTSW 6 135,710,914 (GRCm39) missense probably damaging 1.00
R8457:Grin2b UTSW 6 135,709,197 (GRCm39) missense probably benign 0.00
R8746:Grin2b UTSW 6 135,899,985 (GRCm39) missense probably benign 0.02
R8925:Grin2b UTSW 6 135,749,339 (GRCm39) missense probably damaging 0.97
R8927:Grin2b UTSW 6 135,749,339 (GRCm39) missense probably damaging 0.97
R9075:Grin2b UTSW 6 135,709,509 (GRCm39) frame shift probably null
R9076:Grin2b UTSW 6 135,709,509 (GRCm39) frame shift probably null
R9172:Grin2b UTSW 6 135,756,255 (GRCm39) missense possibly damaging 0.84
R9520:Grin2b UTSW 6 135,710,399 (GRCm39) missense probably damaging 1.00
R9740:Grin2b UTSW 6 135,899,868 (GRCm39) critical splice donor site probably null
RF001:Grin2b UTSW 6 136,021,238 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCTCTGGTGCACGTCTATC -3'
(R):5'- GCAAAGCTCGTTCCCAAAAGAG -3'

Sequencing Primer
(F):5'- GGTGCACGTCTATCTTTAACTAC -3'
(R):5'- ATCGCTGTCATCCTCGTGGG -3'
Posted On 2021-08-31