Mutagenetix > Incidental Mutation

Incidental Mutation 'R8963:Grin2b'

682490

Institutional Source

Beutler Lab

Gene Symbol

Grin2b

Ensembl Gene

ENSMUSG00000030209

Gene Name

glutamate receptor, ionotropic, NMDA2B (epsilon 2)

Synonyms

GluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B

MMRRC Submission

068797-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8963 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

135713233-136173511 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 136044009 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 98 (V98A)

Ref Sequence

ENSEMBL: ENSMUSP00000142696 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905] [ENSMUST00000125905] [ENSMUST00000143943] [ENSMUST00000152012] [ENSMUST00000188999]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000053880
AA Change: V98A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: V98A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	106	306	8.6e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	4.8e-270	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000111905
AA Change: V98A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: V98A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	56	307	4.2e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	2.1e-245	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000125905

Predicted Effect

probably benign
Transcript: ENSMUST00000143943

Predicted Effect

probably damaging
Transcript: ENSMUST00000152012
AA Change: V98A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000142696
Gene: ENSMUSG00000030209
AA Change: V98A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	66	312	1.6e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000188999

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	T	A	5: 9,437,792	N559K	probably damaging	Het
Aatk	T	C	11: 120,012,137	T421A	probably damaging	Het
Adamts12	T	C	15: 11,317,357		probably null	Het
Adgrv1	A	T	13: 81,419,469	V5195E	probably benign	Het
Adora2b	C	T	11: 62,249,157	A19V	possibly damaging	Het
Ankrd28	A	G	14: 31,755,741	C115R	probably benign	Het
Ankrd35	T	A	3: 96,679,687	L106*	probably null	Het
Ankrd44	G	A	1: 54,762,379	A263V	probably damaging	Het
Apol7b	T	C	15: 77,423,920	K125R	possibly damaging	Het
BC005561	T	C	5: 104,517,786	V58A	probably benign	Het
Cacna1c	A	T	6: 118,742,271	L245*	probably null	Het
Cbll1	A	T	12: 31,488,200	H185Q	probably damaging	Het
Ccdc150	A	C	1: 54,272,482	N209T	probably benign	Het
Ccdc88a	T	A	11: 29,498,416	N1465K	possibly damaging	Het
Cfap54	C	A	10: 93,028,700	G124*	probably null	Het
Chml	A	T	1: 175,687,035	L440H	probably damaging	Het
Chrnd	A	T	1: 87,194,881	Q128L	probably damaging	Het
Clvs2	A	T	10: 33,622,681	D84E	probably benign	Het
Ctif	CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC	CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC	18: 75,471,803		probably benign	Het
Cyp2c40	T	A	19: 39,767,482	I463F	possibly damaging	Het
Cyp51	C	A	5: 4,086,519	R425L	probably damaging	Het
Daam1	A	G	12: 71,945,244	T279A	unknown	Het
Ebf2	G	T	14: 67,428,105	V571F	probably benign	Het
Elavl4	A	T	4: 110,206,579	I275N	probably damaging	Het
F11r	A	G	1: 171,460,937	Q116R	probably benign	Het
Foxred2	T	A	15: 77,945,605	D580V	probably benign	Het
Gatad1	A	C	5: 3,641,544	L4R	probably damaging	Het
Gcn1l1	T	A	5: 115,589,094	M670K	probably benign	Het
Greb1	A	T	12: 16,724,884	F171I	probably damaging	Het
Helz2	A	T	2: 181,229,614	V2735E	probably damaging	Het
Hrct1	A	T	4: 43,727,564		probably benign	Het
Ighv1-11	C	T	12: 114,612,244	R117K	probably damaging	Het
Igkv12-46	A	T	6: 69,764,770	S34T	probably damaging	Het
Il27ra	T	A	8: 84,041,082	N71Y	probably damaging	Het
Iqca	G	T	1: 90,139,927	H201N	probably benign	Het
Itgb1bp1	C	T	12: 21,274,863	R64Q	probably damaging	Het
Katnb1	T	C	8: 95,082,891	L13S	probably damaging	Het
Kif26b	G	A	1: 178,916,149	R1270Q	probably benign	Het
Klhdc2	A	T	12: 69,300,291	R77*	probably null	Het
Klra10	A	T	6: 130,272,654		probably null	Het
Large1	A	T	8: 72,815,984	I704N	probably damaging	Het
Lrp1b	G	A	2: 40,998,184	H2241Y	probably benign	Het
Lrpap1	T	A	5: 35,097,657	M212L	probably benign	Het
Mab21l1	A	G	3: 55,782,927		probably benign	Het
Map4k4	A	T	1: 40,000,580	Q44L	probably damaging	Het
Map7d1	A	G	4: 126,236,682	S412P	probably damaging	Het
Me1	A	T	9: 86,598,791	F354I	probably damaging	Het
Nlrp1b	A	G	11: 71,217,832	V281A	probably damaging	Het
Nrip2	A	G	6: 128,408,325	T240A	possibly damaging	Het
Nsmaf	A	G	4: 6,428,471	V203A	probably damaging	Het
Olfr1120	T	A	2: 87,357,606	I54K	possibly damaging	Het
Olfr1284	A	T	2: 111,379,300	Q100L	probably damaging	Het
Olfr229	A	G	9: 39,910,199	Y132C	probably damaging	Het
Olfr722	A	T	14: 49,895,052	M250K	probably benign	Het
P4ha2	T	C	11: 54,114,169	F124L	probably benign	Het
Pcdha9	A	T	18: 36,998,697	D273V	probably benign	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Plxnd1	G	T	6: 115,972,545	S760*	probably null	Het
Polr1b	A	G	2: 129,115,656	T544A	probably benign	Het
Polr2g	T	C	19: 8,794,149	D153G	probably damaging	Het
Pramef8	T	C	4: 143,417,659	Y192H	probably benign	Het
Rad51ap2	A	C	12: 11,456,254	E59A	possibly damaging	Het
Rrm1	A	T	7: 102,456,532	Y285F	probably benign	Het
Ryr3	A	G	2: 112,836,670		probably null	Het
Scaf4	GGCTGCTGCTGCTGCTGCTGCTGCTG	GGCTGCTGCTGCTGCTGCTGCTG	16: 90,229,857		probably benign	Het
Sftpd	A	G	14: 41,183,044	V30A	probably benign	Het
Sirt6	A	G	10: 81,626,544	V7A	probably benign	Het
Ska1	C	T	18: 74,197,568	V188M	probably damaging	Het
Skint8	G	A	4: 111,937,044	M210I	probably benign	Het
Slc6a11	A	G	6: 114,225,821		probably null	Het
Slc6a2	A	T	8: 92,989,074	H280L	probably benign	Het
Sptan1	T	C	2: 29,983,732	V208A	possibly damaging	Het
Taf6l	T	A	19: 8,774,771	T518S	probably benign	Het
Tsc22d1	T	C	14: 76,418,826	M59T	probably benign	Het
Unc5cl	A	G	17: 48,462,333	T282A	probably benign	Het
Vav3	A	G	3: 109,682,913	K260E	probably damaging	Het
Vmn2r53	A	G	7: 12,581,999	V631A	probably damaging	Het
Zfp938	A	T	10: 82,225,453	F444L	possibly damaging	Het

Other mutations in Grin2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Grin2b	APN	6	135736331	missense	possibly damaging	0.55
IGL00835:Grin2b	APN	6	135733570	missense	probably damaging	1.00
IGL01401:Grin2b	APN	6	135736363	missense	probably damaging	1.00
IGL01523:Grin2b	APN	6	136044265	missense	probably null	0.99
IGL01719:Grin2b	APN	6	135733381	missense	probably damaging	0.97
IGL01907:Grin2b	APN	6	135733740	missense	probably damaging	1.00
IGL01996:Grin2b	APN	6	135732586	missense	probably damaging	1.00
IGL02309:Grin2b	APN	6	135736472	missense	probably damaging	1.00
IGL02312:Grin2b	APN	6	135739090	missense	probably damaging	1.00
IGL02409:Grin2b	APN	6	136043908	missense	possibly damaging	0.89
IGL02527:Grin2b	APN	6	135923391	missense	probably damaging	1.00
IGL02535:Grin2b	APN	6	135779369	missense	possibly damaging	0.70
IGL02570:Grin2b	APN	6	135922998	missense	probably damaging	1.00
IGL02702:Grin2b	APN	6	135739132	missense	probably damaging	0.99
IGL03001:Grin2b	APN	6	135739115	missense	probably damaging	1.00
IGL03274:Grin2b	APN	6	135780255	missense	possibly damaging	0.90
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0164:Grin2b	UTSW	6	135778648	splice site	probably benign
R0194:Grin2b	UTSW	6	135779305	missense	probably damaging	1.00
R0594:Grin2b	UTSW	6	135733929	missense	probably damaging	1.00
R1434:Grin2b	UTSW	6	135843195	missense	probably benign	0.04
R1928:Grin2b	UTSW	6	136044046	missense	probably damaging	1.00
R1942:Grin2b	UTSW	6	135732732	missense	possibly damaging	0.93
R1996:Grin2b	UTSW	6	136044211	missense	possibly damaging	0.52
R2002:Grin2b	UTSW	6	135733245	missense	probably damaging	1.00
R2020:Grin2b	UTSW	6	135733896	missense	probably benign	0.12
R2103:Grin2b	UTSW	6	135780140	missense	probably benign	0.02
R2127:Grin2b	UTSW	6	135778700	missense	probably benign	0.03
R2495:Grin2b	UTSW	6	135733182	missense	probably damaging	1.00
R2656:Grin2b	UTSW	6	135733429	missense	probably damaging	1.00
R2847:Grin2b	UTSW	6	135740953	missense	probably damaging	1.00
R2866:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R3196:Grin2b	UTSW	6	135732455	small deletion	probably benign
R3418:Grin2b	UTSW	6	135843110	missense	probably benign	0.02
R3808:Grin2b	UTSW	6	135923271	missense	probably damaging	0.99
R4028:Grin2b	UTSW	6	135736435	missense	probably damaging	1.00
R4602:Grin2b	UTSW	6	135778741	missense	probably damaging	1.00
R4624:Grin2b	UTSW	6	135733825	missense	probably damaging	0.99
R4677:Grin2b	UTSW	6	135774872	missense	probably benign	0.13
R4744:Grin2b	UTSW	6	135778699	missense	probably damaging	1.00
R5020:Grin2b	UTSW	6	135733407	missense	probably benign	0.01
R5051:Grin2b	UTSW	6	135779395	missense	possibly damaging	0.84
R5105:Grin2b	UTSW	6	135732441	missense	probably benign	0.03
R5125:Grin2b	UTSW	6	135923299	missense	possibly damaging	0.89
R5146:Grin2b	UTSW	6	135779342	missense	probably damaging	1.00
R5318:Grin2b	UTSW	6	135733918	missense	probably damaging	0.99
R5349:Grin2b	UTSW	6	136044283	missense	possibly damaging	0.93
R5426:Grin2b	UTSW	6	135732368	missense	probably damaging	1.00
R5438:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5439:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5440:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5530:Grin2b	UTSW	6	135733723	missense	probably benign	0.00
R5603:Grin2b	UTSW	6	135923397	missense	probably damaging	1.00
R5657:Grin2b	UTSW	6	135733087	missense	possibly damaging	0.48
R5788:Grin2b	UTSW	6	135740964	missense	probably benign	0.24
R5941:Grin2b	UTSW	6	135736373	missense	probably damaging	0.99
R6057:Grin2b	UTSW	6	135733944	missense	possibly damaging	0.84
R6137:Grin2b	UTSW	6	135923458	missense	possibly damaging	0.89
R6216:Grin2b	UTSW	6	135772399	missense	probably damaging	1.00
R6309:Grin2b	UTSW	6	135733027	missense	probably benign	0.00
R6316:Grin2b	UTSW	6	135780279	missense	probably benign	0.00
R6419:Grin2b	UTSW	6	135740967	missense	probably damaging	1.00
R6551:Grin2b	UTSW	6	135733344	missense	probably damaging	1.00
R6612:Grin2b	UTSW	6	135740998	missense	probably damaging	1.00
R6616:Grin2b	UTSW	6	135732551	missense	probably benign
R6647:Grin2b	UTSW	6	135733110	missense	probably damaging	1.00
R6806:Grin2b	UTSW	6	135774828	missense	possibly damaging	0.84
R6976:Grin2b	UTSW	6	135780200	missense	probably benign
R7033:Grin2b	UTSW	6	135923038	missense	probably damaging	1.00
R7058:Grin2b	UTSW	6	135780306	missense	probably damaging	0.97
R7144:Grin2b	UTSW	6	135733476	missense	possibly damaging	0.50
R7190:Grin2b	UTSW	6	135732948	missense	possibly damaging	0.46
R7238:Grin2b	UTSW	6	135780251	missense	probably damaging	0.97
R7453:Grin2b	UTSW	6	135740949	missense	possibly damaging	0.56
R7553:Grin2b	UTSW	6	135772396	missense	possibly damaging	0.88
R7585:Grin2b	UTSW	6	135779303	missense	probably damaging	0.99
R7615:Grin2b	UTSW	6	135923364	missense	probably damaging	1.00
R7632:Grin2b	UTSW	6	135732555	missense	probably benign	0.02
R7779:Grin2b	UTSW	6	135778794	nonsense	probably null
R8058:Grin2b	UTSW	6	135733227	missense	probably damaging	1.00
R8084:Grin2b	UTSW	6	135733488	missense	probably benign	0.03
R8145:Grin2b	UTSW	6	135732499	missense	probably benign	0.01
R8308:Grin2b	UTSW	6	135923076	missense	probably damaging	0.99
R8357:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8379:Grin2b	UTSW	6	135922969	missense	probably damaging	1.00
R8429:Grin2b	UTSW	6	135733916	missense	probably damaging	1.00
R8457:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8746:Grin2b	UTSW	6	135922987	missense	probably benign	0.02
R8925:Grin2b	UTSW	6	135772341	missense	probably damaging	0.97
R8927:Grin2b	UTSW	6	135772341	missense	probably damaging	0.97
R9075:Grin2b	UTSW	6	135732511	frame shift	probably null
R9076:Grin2b	UTSW	6	135732511	frame shift	probably null
R9172:Grin2b	UTSW	6	135779257	missense	possibly damaging	0.84
R9520:Grin2b	UTSW	6	135733401	missense	probably damaging	1.00
R9740:Grin2b	UTSW	6	135922870	critical splice donor site	probably null
RF001:Grin2b	UTSW	6	136044240	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCTCTGGTGCACGTCTATC -3'
(R):5'- GCAAAGCTCGTTCCCAAAAGAG -3'

Sequencing Primer
(F):5'- GGTGCACGTCTATCTTTAACTAC -3'
(R):5'- ATCGCTGTCATCCTCGTGGG -3'

Posted On

2021-08-31