Incidental Mutation 'R8963:Grin2b'
ID 682490
Institutional Source Beutler Lab
Gene Symbol Grin2b
Ensembl Gene ENSMUSG00000030209
Gene Name glutamate receptor, ionotropic, NMDA2B (epsilon 2)
Synonyms GluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8963 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 135713233-136173511 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 136044009 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 98 (V98A)
Ref Sequence ENSEMBL: ENSMUSP00000142696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905] [ENSMUST00000125905] [ENSMUST00000143943] [ENSMUST00000152012] [ENSMUST00000188999]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000053880
AA Change: V98A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: V98A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 106 306 8.6e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 4.8e-270 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111905
AA Change: V98A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: V98A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 56 307 4.2e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 2.1e-245 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125905
Predicted Effect probably benign
Transcript: ENSMUST00000143943
Predicted Effect probably damaging
Transcript: ENSMUST00000152012
AA Change: V98A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142696
Gene: ENSMUSG00000030209
AA Change: V98A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 66 312 1.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188999
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T A 5: 9,437,792 N559K probably damaging Het
Aatk T C 11: 120,012,137 T421A probably damaging Het
Adamts12 T C 15: 11,317,357 probably null Het
Adgrv1 A T 13: 81,419,469 V5195E probably benign Het
Adora2b C T 11: 62,249,157 A19V possibly damaging Het
Ankrd28 A G 14: 31,755,741 C115R probably benign Het
Ankrd35 T A 3: 96,679,687 L106* probably null Het
Ankrd44 G A 1: 54,762,379 A263V probably damaging Het
Apol7b T C 15: 77,423,920 K125R possibly damaging Het
BC005561 T C 5: 104,517,786 V58A probably benign Het
Cacna1c A T 6: 118,742,271 L245* probably null Het
Cbll1 A T 12: 31,488,200 H185Q probably damaging Het
Ccdc150 A C 1: 54,272,482 N209T probably benign Het
Ccdc88a T A 11: 29,498,416 N1465K possibly damaging Het
Cfap54 C A 10: 93,028,700 G124* probably null Het
Chml A T 1: 175,687,035 L440H probably damaging Het
Chrnd A T 1: 87,194,881 Q128L probably damaging Het
Clvs2 A T 10: 33,622,681 D84E probably benign Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Cyp2c40 T A 19: 39,767,482 I463F possibly damaging Het
Cyp51 C A 5: 4,086,519 R425L probably damaging Het
Daam1 A G 12: 71,945,244 T279A unknown Het
Ebf2 G T 14: 67,428,105 V571F probably benign Het
Elavl4 A T 4: 110,206,579 I275N probably damaging Het
F11r A G 1: 171,460,937 Q116R probably benign Het
Foxred2 T A 15: 77,945,605 D580V probably benign Het
Gatad1 A C 5: 3,641,544 L4R probably damaging Het
Gcn1l1 T A 5: 115,589,094 M670K probably benign Het
Greb1 A T 12: 16,724,884 F171I probably damaging Het
Helz2 A T 2: 181,229,614 V2735E probably damaging Het
Hrct1 A T 4: 43,727,564 probably benign Het
Ighv1-11 C T 12: 114,612,244 R117K probably damaging Het
Igkv12-46 A T 6: 69,764,770 S34T probably damaging Het
Il27ra T A 8: 84,041,082 N71Y probably damaging Het
Iqca G T 1: 90,139,927 H201N probably benign Het
Itgb1bp1 C T 12: 21,274,863 R64Q probably damaging Het
Katnb1 T C 8: 95,082,891 L13S probably damaging Het
Kif26b G A 1: 178,916,149 R1270Q probably benign Het
Klhdc2 A T 12: 69,300,291 R77* probably null Het
Klra10 A T 6: 130,272,654 probably null Het
Large1 A T 8: 72,815,984 I704N probably damaging Het
Lrp1b G A 2: 40,998,184 H2241Y probably benign Het
Lrpap1 T A 5: 35,097,657 M212L probably benign Het
Mab21l1 A G 3: 55,782,927 probably benign Het
Map4k4 A T 1: 40,000,580 Q44L probably damaging Het
Map7d1 A G 4: 126,236,682 S412P probably damaging Het
Me1 A T 9: 86,598,791 F354I probably damaging Het
Nlrp1b A G 11: 71,217,832 V281A probably damaging Het
Nrip2 A G 6: 128,408,325 T240A possibly damaging Het
Nsmaf A G 4: 6,428,471 V203A probably damaging Het
Olfr1120 T A 2: 87,357,606 I54K possibly damaging Het
Olfr1284 A T 2: 111,379,300 Q100L probably damaging Het
Olfr229 A G 9: 39,910,199 Y132C probably damaging Het
Olfr722 A T 14: 49,895,052 M250K probably benign Het
P4ha2 T C 11: 54,114,169 F124L probably benign Het
Pcdha9 A T 18: 36,998,697 D273V probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plxnd1 G T 6: 115,972,545 S760* probably null Het
Polr1b A G 2: 129,115,656 T544A probably benign Het
Polr2g T C 19: 8,794,149 D153G probably damaging Het
Pramef8 T C 4: 143,417,659 Y192H probably benign Het
Rad51ap2 A C 12: 11,456,254 E59A possibly damaging Het
Rrm1 A T 7: 102,456,532 Y285F probably benign Het
Ryr3 A G 2: 112,836,670 probably null Het
Scaf4 GGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTG 16: 90,229,857 probably benign Het
Sftpd A G 14: 41,183,044 V30A probably benign Het
Sirt6 A G 10: 81,626,544 V7A probably benign Het
Ska1 C T 18: 74,197,568 V188M probably damaging Het
Skint8 G A 4: 111,937,044 M210I probably benign Het
Slc6a11 A G 6: 114,225,821 probably null Het
Slc6a2 A T 8: 92,989,074 H280L probably benign Het
Sptan1 T C 2: 29,983,732 V208A possibly damaging Het
Taf6l T A 19: 8,774,771 T518S probably benign Het
Tsc22d1 T C 14: 76,418,826 M59T probably benign Het
Unc5cl A G 17: 48,462,333 T282A probably benign Het
Vav3 A G 3: 109,682,913 K260E probably damaging Het
Vmn2r53 A G 7: 12,581,999 V631A probably damaging Het
Zfp938 A T 10: 82,225,453 F444L possibly damaging Het
Other mutations in Grin2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Grin2b APN 6 135736331 missense possibly damaging 0.55
IGL00835:Grin2b APN 6 135733570 missense probably damaging 1.00
IGL01401:Grin2b APN 6 135736363 missense probably damaging 1.00
IGL01523:Grin2b APN 6 136044265 missense probably null 0.99
IGL01719:Grin2b APN 6 135733381 missense probably damaging 0.97
IGL01907:Grin2b APN 6 135733740 missense probably damaging 1.00
IGL01996:Grin2b APN 6 135732586 missense probably damaging 1.00
IGL02309:Grin2b APN 6 135736472 missense probably damaging 1.00
IGL02312:Grin2b APN 6 135739090 missense probably damaging 1.00
IGL02409:Grin2b APN 6 136043908 missense possibly damaging 0.89
IGL02527:Grin2b APN 6 135923391 missense probably damaging 1.00
IGL02535:Grin2b APN 6 135779369 missense possibly damaging 0.70
IGL02570:Grin2b APN 6 135922998 missense probably damaging 1.00
IGL02702:Grin2b APN 6 135739132 missense probably damaging 0.99
IGL03001:Grin2b APN 6 135739115 missense probably damaging 1.00
IGL03274:Grin2b APN 6 135780255 missense possibly damaging 0.90
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0164:Grin2b UTSW 6 135778648 splice site probably benign
R0194:Grin2b UTSW 6 135779305 missense probably damaging 1.00
R0594:Grin2b UTSW 6 135733929 missense probably damaging 1.00
R1434:Grin2b UTSW 6 135843195 missense probably benign 0.04
R1928:Grin2b UTSW 6 136044046 missense probably damaging 1.00
R1942:Grin2b UTSW 6 135732732 missense possibly damaging 0.93
R1996:Grin2b UTSW 6 136044211 missense possibly damaging 0.52
R2002:Grin2b UTSW 6 135733245 missense probably damaging 1.00
R2020:Grin2b UTSW 6 135733896 missense probably benign 0.12
R2103:Grin2b UTSW 6 135780140 missense probably benign 0.02
R2127:Grin2b UTSW 6 135778700 missense probably benign 0.03
R2495:Grin2b UTSW 6 135733182 missense probably damaging 1.00
R2656:Grin2b UTSW 6 135733429 missense probably damaging 1.00
R2847:Grin2b UTSW 6 135740953 missense probably damaging 1.00
R2866:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R3196:Grin2b UTSW 6 135732455 small deletion probably benign
R3418:Grin2b UTSW 6 135843110 missense probably benign 0.02
R3808:Grin2b UTSW 6 135923271 missense probably damaging 0.99
R4028:Grin2b UTSW 6 135736435 missense probably damaging 1.00
R4602:Grin2b UTSW 6 135778741 missense probably damaging 1.00
R4624:Grin2b UTSW 6 135733825 missense probably damaging 0.99
R4677:Grin2b UTSW 6 135774872 missense probably benign 0.13
R4744:Grin2b UTSW 6 135778699 missense probably damaging 1.00
R5020:Grin2b UTSW 6 135733407 missense probably benign 0.01
R5051:Grin2b UTSW 6 135779395 missense possibly damaging 0.84
R5105:Grin2b UTSW 6 135732441 missense probably benign 0.03
R5125:Grin2b UTSW 6 135923299 missense possibly damaging 0.89
R5146:Grin2b UTSW 6 135779342 missense probably damaging 1.00
R5318:Grin2b UTSW 6 135733918 missense probably damaging 0.99
R5349:Grin2b UTSW 6 136044283 missense possibly damaging 0.93
R5426:Grin2b UTSW 6 135732368 missense probably damaging 1.00
R5438:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5439:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5440:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5530:Grin2b UTSW 6 135733723 missense probably benign 0.00
R5603:Grin2b UTSW 6 135923397 missense probably damaging 1.00
R5657:Grin2b UTSW 6 135733087 missense possibly damaging 0.48
R5788:Grin2b UTSW 6 135740964 missense probably benign 0.24
R5941:Grin2b UTSW 6 135736373 missense probably damaging 0.99
R6057:Grin2b UTSW 6 135733944 missense possibly damaging 0.84
R6137:Grin2b UTSW 6 135923458 missense possibly damaging 0.89
R6216:Grin2b UTSW 6 135772399 missense probably damaging 1.00
R6309:Grin2b UTSW 6 135733027 missense probably benign 0.00
R6316:Grin2b UTSW 6 135780279 missense probably benign 0.00
R6419:Grin2b UTSW 6 135740967 missense probably damaging 1.00
R6551:Grin2b UTSW 6 135733344 missense probably damaging 1.00
R6612:Grin2b UTSW 6 135740998 missense probably damaging 1.00
R6616:Grin2b UTSW 6 135732551 missense probably benign
R6647:Grin2b UTSW 6 135733110 missense probably damaging 1.00
R6806:Grin2b UTSW 6 135774828 missense possibly damaging 0.84
R6976:Grin2b UTSW 6 135780200 missense probably benign
R7033:Grin2b UTSW 6 135923038 missense probably damaging 1.00
R7058:Grin2b UTSW 6 135780306 missense probably damaging 0.97
R7144:Grin2b UTSW 6 135733476 missense possibly damaging 0.50
R7190:Grin2b UTSW 6 135732948 missense possibly damaging 0.46
R7238:Grin2b UTSW 6 135780251 missense probably damaging 0.97
R7453:Grin2b UTSW 6 135740949 missense possibly damaging 0.56
R7553:Grin2b UTSW 6 135772396 missense possibly damaging 0.88
R7585:Grin2b UTSW 6 135779303 missense probably damaging 0.99
R7615:Grin2b UTSW 6 135923364 missense probably damaging 1.00
R7632:Grin2b UTSW 6 135732555 missense probably benign 0.02
R7779:Grin2b UTSW 6 135778794 nonsense probably null
R8058:Grin2b UTSW 6 135733227 missense probably damaging 1.00
R8084:Grin2b UTSW 6 135733488 missense probably benign 0.03
R8145:Grin2b UTSW 6 135732499 missense probably benign 0.01
R8308:Grin2b UTSW 6 135923076 missense probably damaging 0.99
R8357:Grin2b UTSW 6 135732199 missense probably benign 0.00
R8379:Grin2b UTSW 6 135922969 missense probably damaging 1.00
R8429:Grin2b UTSW 6 135733916 missense probably damaging 1.00
R8457:Grin2b UTSW 6 135732199 missense probably benign 0.00
R8746:Grin2b UTSW 6 135922987 missense probably benign 0.02
R8925:Grin2b UTSW 6 135772341 missense probably damaging 0.97
R8927:Grin2b UTSW 6 135772341 missense probably damaging 0.97
R9075:Grin2b UTSW 6 135732511 frame shift probably null
R9076:Grin2b UTSW 6 135732511 frame shift probably null
R9172:Grin2b UTSW 6 135779257 missense possibly damaging 0.84
RF001:Grin2b UTSW 6 136044240 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCTCTGGTGCACGTCTATC -3'
(R):5'- GCAAAGCTCGTTCCCAAAAGAG -3'

Sequencing Primer
(F):5'- GGTGCACGTCTATCTTTAACTAC -3'
(R):5'- ATCGCTGTCATCCTCGTGGG -3'
Posted On 2021-08-31