Incidental Mutation 'R8963:Vmn2r53'
ID 682491
Institutional Source Beutler Lab
Gene Symbol Vmn2r53
Ensembl Gene ENSMUSG00000096002
Gene Name vomeronasal 2, receptor 53
Synonyms EG637908
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock # R8963 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 12581470-12606544 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 12581999 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 631 (V631A)
Ref Sequence ENSEMBL: ENSMUSP00000126979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170412]
AlphaFold A0A3B2W4A7
Predicted Effect probably damaging
Transcript: ENSMUST00000170412
AA Change: V631A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126979
Gene: ENSMUSG00000096002
AA Change: V631A

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 3.6e-58 PFAM
Pfam:NCD3G 442 495 2.2e-19 PFAM
Pfam:7tm_3 526 763 3.1e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T A 5: 9,437,792 N559K probably damaging Het
Aatk T C 11: 120,012,137 T421A probably damaging Het
Adamts12 T C 15: 11,317,357 probably null Het
Adgrv1 A T 13: 81,419,469 V5195E probably benign Het
Adora2b C T 11: 62,249,157 A19V possibly damaging Het
Ankrd28 A G 14: 31,755,741 C115R probably benign Het
Ankrd35 T A 3: 96,679,687 L106* probably null Het
Ankrd44 G A 1: 54,762,379 A263V probably damaging Het
Apol7b T C 15: 77,423,920 K125R possibly damaging Het
BC005561 T C 5: 104,517,786 V58A probably benign Het
Cacna1c A T 6: 118,742,271 L245* probably null Het
Cbll1 A T 12: 31,488,200 H185Q probably damaging Het
Ccdc150 A C 1: 54,272,482 N209T probably benign Het
Ccdc88a T A 11: 29,498,416 N1465K possibly damaging Het
Cfap54 C A 10: 93,028,700 G124* probably null Het
Chml A T 1: 175,687,035 L440H probably damaging Het
Chrnd A T 1: 87,194,881 Q128L probably damaging Het
Clvs2 A T 10: 33,622,681 D84E probably benign Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Cyp2c40 T A 19: 39,767,482 I463F possibly damaging Het
Cyp51 C A 5: 4,086,519 R425L probably damaging Het
Daam1 A G 12: 71,945,244 T279A unknown Het
Ebf2 G T 14: 67,428,105 V571F probably benign Het
Elavl4 A T 4: 110,206,579 I275N probably damaging Het
F11r A G 1: 171,460,937 Q116R probably benign Het
Foxred2 T A 15: 77,945,605 D580V probably benign Het
Gatad1 A C 5: 3,641,544 L4R probably damaging Het
Gcn1l1 T A 5: 115,589,094 M670K probably benign Het
Greb1 A T 12: 16,724,884 F171I probably damaging Het
Grin2b A G 6: 136,044,009 V98A probably damaging Het
Helz2 A T 2: 181,229,614 V2735E probably damaging Het
Hrct1 A T 4: 43,727,564 probably benign Het
Ighv1-11 C T 12: 114,612,244 R117K probably damaging Het
Igkv12-46 A T 6: 69,764,770 S34T probably damaging Het
Il27ra T A 8: 84,041,082 N71Y probably damaging Het
Iqca G T 1: 90,139,927 H201N probably benign Het
Itgb1bp1 C T 12: 21,274,863 R64Q probably damaging Het
Katnb1 T C 8: 95,082,891 L13S probably damaging Het
Kif26b G A 1: 178,916,149 R1270Q probably benign Het
Klhdc2 A T 12: 69,300,291 R77* probably null Het
Klra10 A T 6: 130,272,654 probably null Het
Large1 A T 8: 72,815,984 I704N probably damaging Het
Lrp1b G A 2: 40,998,184 H2241Y probably benign Het
Lrpap1 T A 5: 35,097,657 M212L probably benign Het
Mab21l1 A G 3: 55,782,927 probably benign Het
Map4k4 A T 1: 40,000,580 Q44L probably damaging Het
Map7d1 A G 4: 126,236,682 S412P probably damaging Het
Me1 A T 9: 86,598,791 F354I probably damaging Het
Nlrp1b A G 11: 71,217,832 V281A probably damaging Het
Nrip2 A G 6: 128,408,325 T240A possibly damaging Het
Nsmaf A G 4: 6,428,471 V203A probably damaging Het
Olfr1120 T A 2: 87,357,606 I54K possibly damaging Het
Olfr1284 A T 2: 111,379,300 Q100L probably damaging Het
Olfr229 A G 9: 39,910,199 Y132C probably damaging Het
Olfr722 A T 14: 49,895,052 M250K probably benign Het
P4ha2 T C 11: 54,114,169 F124L probably benign Het
Pcdha9 A T 18: 36,998,697 D273V probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plxnd1 G T 6: 115,972,545 S760* probably null Het
Polr1b A G 2: 129,115,656 T544A probably benign Het
Polr2g T C 19: 8,794,149 D153G probably damaging Het
Pramef8 T C 4: 143,417,659 Y192H probably benign Het
Rad51ap2 A C 12: 11,456,254 E59A possibly damaging Het
Rrm1 A T 7: 102,456,532 Y285F probably benign Het
Ryr3 A G 2: 112,836,670 probably null Het
Scaf4 GGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTG 16: 90,229,857 probably benign Het
Sftpd A G 14: 41,183,044 V30A probably benign Het
Sirt6 A G 10: 81,626,544 V7A probably benign Het
Ska1 C T 18: 74,197,568 V188M probably damaging Het
Skint8 G A 4: 111,937,044 M210I probably benign Het
Slc6a11 A G 6: 114,225,821 probably null Het
Slc6a2 A T 8: 92,989,074 H280L probably benign Het
Sptan1 T C 2: 29,983,732 V208A possibly damaging Het
Taf6l T A 19: 8,774,771 T518S probably benign Het
Tsc22d1 T C 14: 76,418,826 M59T probably benign Het
Unc5cl A G 17: 48,462,333 T282A probably benign Het
Vav3 A G 3: 109,682,913 K260E probably damaging Het
Zfp938 A T 10: 82,225,453 F444L possibly damaging Het
Other mutations in Vmn2r53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Vmn2r53 APN 7 12600908 missense possibly damaging 0.70
IGL01997:Vmn2r53 APN 7 12582446 missense possibly damaging 0.54
IGL02442:Vmn2r53 APN 7 12581729 missense probably damaging 1.00
IGL02449:Vmn2r53 APN 7 12582361 missense probably damaging 1.00
IGL02589:Vmn2r53 APN 7 12581945 missense possibly damaging 0.93
IGL02986:Vmn2r53 APN 7 12581466 unclassified probably benign
IGL03064:Vmn2r53 APN 7 12601010 missense possibly damaging 0.89
IGL03093:Vmn2r53 APN 7 12600864 missense probably benign 0.03
IGL03244:Vmn2r53 APN 7 12606508 missense probably damaging 1.00
IGL03252:Vmn2r53 APN 7 12606391 missense probably damaging 1.00
IGL03264:Vmn2r53 APN 7 12581892 missense possibly damaging 0.95
IGL03293:Vmn2r53 APN 7 12598422 missense probably benign 0.34
R0109:Vmn2r53 UTSW 7 12582066 missense probably damaging 1.00
R0453:Vmn2r53 UTSW 7 12582411 missense probably damaging 1.00
R0735:Vmn2r53 UTSW 7 12581780 missense probably benign
R0881:Vmn2r53 UTSW 7 12600932 missense probably benign 0.01
R0894:Vmn2r53 UTSW 7 12601214 missense probably benign 0.00
R0973:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0973:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0974:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0990:Vmn2r53 UTSW 7 12581502 missense probably benign
R1102:Vmn2r53 UTSW 7 12598483 missense possibly damaging 0.94
R1141:Vmn2r53 UTSW 7 12600746 missense possibly damaging 0.54
R1263:Vmn2r53 UTSW 7 12581606 missense probably benign 0.41
R1343:Vmn2r53 UTSW 7 12584774 missense probably benign 0.08
R1750:Vmn2r53 UTSW 7 12581705 missense probably damaging 1.00
R1836:Vmn2r53 UTSW 7 12600885 missense probably damaging 1.00
R2035:Vmn2r53 UTSW 7 12598511 missense possibly damaging 0.76
R2202:Vmn2r53 UTSW 7 12601439 missense probably damaging 1.00
R3707:Vmn2r53 UTSW 7 12582054 missense possibly damaging 0.95
R4372:Vmn2r53 UTSW 7 12581729 missense probably damaging 0.98
R4615:Vmn2r53 UTSW 7 12582302 missense probably damaging 1.00
R4655:Vmn2r53 UTSW 7 12582005 missense possibly damaging 0.83
R4663:Vmn2r53 UTSW 7 12600974 missense probably benign 0.21
R4708:Vmn2r53 UTSW 7 12601202 missense probably benign
R4710:Vmn2r53 UTSW 7 12601202 missense probably benign
R4774:Vmn2r53 UTSW 7 12600765 nonsense probably null
R4859:Vmn2r53 UTSW 7 12601403 missense probably damaging 1.00
R5061:Vmn2r53 UTSW 7 12581814 missense probably benign 0.01
R5561:Vmn2r53 UTSW 7 12601420 missense probably damaging 1.00
R5729:Vmn2r53 UTSW 7 12600806 missense probably damaging 1.00
R6004:Vmn2r53 UTSW 7 12582401 missense probably benign 0.12
R6083:Vmn2r53 UTSW 7 12581881 missense probably benign
R6312:Vmn2r53 UTSW 7 12598639 critical splice acceptor site probably null
R6700:Vmn2r53 UTSW 7 12581706 missense probably damaging 0.96
R6783:Vmn2r53 UTSW 7 12601433 missense probably damaging 1.00
R6852:Vmn2r53 UTSW 7 12606514 missense probably damaging 0.99
R6889:Vmn2r53 UTSW 7 12601142 missense probably benign 0.10
R6940:Vmn2r53 UTSW 7 12582416 missense probably benign 0.19
R7100:Vmn2r53 UTSW 7 12581586 nonsense probably null
R7174:Vmn2r53 UTSW 7 12581701 missense probably benign 0.01
R7213:Vmn2r53 UTSW 7 12601056 missense probably benign 0.17
R7276:Vmn2r53 UTSW 7 12606432 missense probably damaging 0.99
R7515:Vmn2r53 UTSW 7 12581919 missense probably benign 0.05
R7678:Vmn2r53 UTSW 7 12598498 missense probably benign 0.04
R7714:Vmn2r53 UTSW 7 12606491 missense probably damaging 1.00
R7843:Vmn2r53 UTSW 7 12582099 missense probably damaging 1.00
R8208:Vmn2r53 UTSW 7 12601395 missense probably damaging 1.00
R8211:Vmn2r53 UTSW 7 12581916 missense probably benign 0.01
R8478:Vmn2r53 UTSW 7 12606354 missense probably benign 0.01
R8853:Vmn2r53 UTSW 7 12581810 missense probably damaging 1.00
R8924:Vmn2r53 UTSW 7 12600825 missense probably benign 0.17
R9042:Vmn2r53 UTSW 7 12581508 missense probably benign
R9076:Vmn2r53 UTSW 7 12606304 missense probably damaging 1.00
R9407:Vmn2r53 UTSW 7 12601197 missense probably damaging 0.99
R9690:Vmn2r53 UTSW 7 12581985 missense probably damaging 1.00
Z1176:Vmn2r53 UTSW 7 12601304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCATTGAAGACATCTGGAAGGC -3'
(R):5'- GAGACCCACTGTTACTACCTGC -3'

Sequencing Primer
(F):5'- AAGACATCTGGAAGGCCCCTG -3'
(R):5'- GCCTCCTCCGTCAGACCATC -3'
Posted On 2021-08-31