Incidental Mutation 'R8963:Rrm1'
ID 682492
Institutional Source Beutler Lab
Gene Symbol Rrm1
Ensembl Gene ENSMUSG00000030978
Gene Name ribonucleotide reductase M1
Synonyms RnrM1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock # R8963 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 102441695-102469771 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 102456532 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 285 (Y285F)
Ref Sequence ENSEMBL: ENSMUSP00000033283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033283]
AlphaFold P07742
Predicted Effect probably benign
Transcript: ENSMUST00000033283
AA Change: Y285F

PolyPhen 2 Score 0.234 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000033283
Gene: ENSMUSG00000030978
AA Change: Y285F

DomainStartEndE-ValueType
Pfam:ATP-cone 1 89 8.7e-21 PFAM
Pfam:Ribonuc_red_lgN 141 213 2.8e-25 PFAM
Pfam:Ribonuc_red_lgC 216 738 1.6e-197 PFAM
coiled coil region 749 778 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the large and catalytic subunit of ribonucleotide reductase, an enzyme essential for the conversion of ribonucleotides into deoxyribonucleotides. A pool of available deoxyribonucleotides is important for DNA replication during S phase of the cell cycle as well as multiple DNA repair processes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic letahlity before E3.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T A 5: 9,437,792 N559K probably damaging Het
Aatk T C 11: 120,012,137 T421A probably damaging Het
Adamts12 T C 15: 11,317,357 probably null Het
Adgrv1 A T 13: 81,419,469 V5195E probably benign Het
Adora2b C T 11: 62,249,157 A19V possibly damaging Het
Ankrd28 A G 14: 31,755,741 C115R probably benign Het
Ankrd35 T A 3: 96,679,687 L106* probably null Het
Ankrd44 G A 1: 54,762,379 A263V probably damaging Het
Apol7b T C 15: 77,423,920 K125R possibly damaging Het
BC005561 T C 5: 104,517,786 V58A probably benign Het
Cacna1c A T 6: 118,742,271 L245* probably null Het
Cbll1 A T 12: 31,488,200 H185Q probably damaging Het
Ccdc150 A C 1: 54,272,482 N209T probably benign Het
Ccdc88a T A 11: 29,498,416 N1465K possibly damaging Het
Cfap54 C A 10: 93,028,700 G124* probably null Het
Chml A T 1: 175,687,035 L440H probably damaging Het
Chrnd A T 1: 87,194,881 Q128L probably damaging Het
Clvs2 A T 10: 33,622,681 D84E probably benign Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Cyp2c40 T A 19: 39,767,482 I463F possibly damaging Het
Cyp51 C A 5: 4,086,519 R425L probably damaging Het
Daam1 A G 12: 71,945,244 T279A unknown Het
Ebf2 G T 14: 67,428,105 V571F probably benign Het
Elavl4 A T 4: 110,206,579 I275N probably damaging Het
F11r A G 1: 171,460,937 Q116R probably benign Het
Foxred2 T A 15: 77,945,605 D580V probably benign Het
Gatad1 A C 5: 3,641,544 L4R probably damaging Het
Gcn1l1 T A 5: 115,589,094 M670K probably benign Het
Greb1 A T 12: 16,724,884 F171I probably damaging Het
Grin2b A G 6: 136,044,009 V98A probably damaging Het
Helz2 A T 2: 181,229,614 V2735E probably damaging Het
Hrct1 A T 4: 43,727,564 probably benign Het
Ighv1-11 C T 12: 114,612,244 R117K probably damaging Het
Igkv12-46 A T 6: 69,764,770 S34T probably damaging Het
Il27ra T A 8: 84,041,082 N71Y probably damaging Het
Iqca G T 1: 90,139,927 H201N probably benign Het
Itgb1bp1 C T 12: 21,274,863 R64Q probably damaging Het
Katnb1 T C 8: 95,082,891 L13S probably damaging Het
Kif26b G A 1: 178,916,149 R1270Q probably benign Het
Klhdc2 A T 12: 69,300,291 R77* probably null Het
Klra10 A T 6: 130,272,654 probably null Het
Large1 A T 8: 72,815,984 I704N probably damaging Het
Lrp1b G A 2: 40,998,184 H2241Y probably benign Het
Lrpap1 T A 5: 35,097,657 M212L probably benign Het
Mab21l1 A G 3: 55,782,927 probably benign Het
Map4k4 A T 1: 40,000,580 Q44L probably damaging Het
Map7d1 A G 4: 126,236,682 S412P probably damaging Het
Me1 A T 9: 86,598,791 F354I probably damaging Het
Nlrp1b A G 11: 71,217,832 V281A probably damaging Het
Nrip2 A G 6: 128,408,325 T240A possibly damaging Het
Nsmaf A G 4: 6,428,471 V203A probably damaging Het
Olfr1120 T A 2: 87,357,606 I54K possibly damaging Het
Olfr1284 A T 2: 111,379,300 Q100L probably damaging Het
Olfr229 A G 9: 39,910,199 Y132C probably damaging Het
Olfr722 A T 14: 49,895,052 M250K probably benign Het
P4ha2 T C 11: 54,114,169 F124L probably benign Het
Pcdha9 A T 18: 36,998,697 D273V probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plxnd1 G T 6: 115,972,545 S760* probably null Het
Polr1b A G 2: 129,115,656 T544A probably benign Het
Polr2g T C 19: 8,794,149 D153G probably damaging Het
Pramef8 T C 4: 143,417,659 Y192H probably benign Het
Rad51ap2 A C 12: 11,456,254 E59A possibly damaging Het
Ryr3 A G 2: 112,836,670 probably null Het
Scaf4 GGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTG 16: 90,229,857 probably benign Het
Sftpd A G 14: 41,183,044 V30A probably benign Het
Sirt6 A G 10: 81,626,544 V7A probably benign Het
Ska1 C T 18: 74,197,568 V188M probably damaging Het
Skint8 G A 4: 111,937,044 M210I probably benign Het
Slc6a11 A G 6: 114,225,821 probably null Het
Slc6a2 A T 8: 92,989,074 H280L probably benign Het
Sptan1 T C 2: 29,983,732 V208A possibly damaging Het
Taf6l T A 19: 8,774,771 T518S probably benign Het
Tsc22d1 T C 14: 76,418,826 M59T probably benign Het
Unc5cl A G 17: 48,462,333 T282A probably benign Het
Vav3 A G 3: 109,682,913 K260E probably damaging Het
Vmn2r53 A G 7: 12,581,999 V631A probably damaging Het
Zfp938 A T 10: 82,225,453 F444L possibly damaging Het
Other mutations in Rrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rrm1 APN 7 102454507 nonsense probably null
IGL01431:Rrm1 APN 7 102457552 splice site probably benign
IGL03251:Rrm1 APN 7 102457206 missense probably damaging 1.00
IGL03401:Rrm1 APN 7 102465744 missense possibly damaging 0.81
Arabica UTSW 7 102460351 missense probably damaging 1.00
Pentose UTSW 7 102460856 splice site probably null
R0454:Rrm1 UTSW 7 102466926 missense probably damaging 1.00
R0548:Rrm1 UTSW 7 102467067 critical splice donor site probably null
R0759:Rrm1 UTSW 7 102457561 missense probably benign 0.32
R1575:Rrm1 UTSW 7 102456514 missense probably damaging 1.00
R1586:Rrm1 UTSW 7 102466905 makesense probably null
R1625:Rrm1 UTSW 7 102468347 missense probably damaging 0.98
R2207:Rrm1 UTSW 7 102442026 start codon destroyed probably null 0.98
R2432:Rrm1 UTSW 7 102443072 missense probably benign 0.03
R2513:Rrm1 UTSW 7 102460689 missense probably damaging 0.99
R3796:Rrm1 UTSW 7 102465703 splice site probably null
R3914:Rrm1 UTSW 7 102457174 missense probably damaging 1.00
R4179:Rrm1 UTSW 7 102457198 missense probably damaging 1.00
R4302:Rrm1 UTSW 7 102447824 missense probably benign 0.00
R4379:Rrm1 UTSW 7 102446593 missense probably damaging 1.00
R4416:Rrm1 UTSW 7 102447801 missense probably benign 0.06
R4690:Rrm1 UTSW 7 102447879 missense probably benign
R4939:Rrm1 UTSW 7 102466924 missense probably benign 0.34
R5433:Rrm1 UTSW 7 102465767 missense probably damaging 0.97
R5445:Rrm1 UTSW 7 102451023 missense possibly damaging 0.77
R6120:Rrm1 UTSW 7 102460856 splice site probably null
R6198:Rrm1 UTSW 7 102446729 critical splice donor site probably null
R6369:Rrm1 UTSW 7 102446702 missense probably damaging 0.97
R6699:Rrm1 UTSW 7 102460825 missense probably damaging 1.00
R7009:Rrm1 UTSW 7 102460334 missense probably damaging 1.00
R7491:Rrm1 UTSW 7 102454557 missense probably damaging 1.00
R8024:Rrm1 UTSW 7 102457265 missense probably benign 0.00
R8276:Rrm1 UTSW 7 102460852 critical splice donor site probably null
R8713:Rrm1 UTSW 7 102460351 missense probably damaging 1.00
R8968:Rrm1 UTSW 7 102468338 missense probably benign 0.03
R9028:Rrm1 UTSW 7 102460398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGGTTCCTAGGAAATTAGTCAGTG -3'
(R):5'- GAACTCTAGAACTTAGTTCCTAGCTAC -3'

Sequencing Primer
(F):5'- AGTCAGTGTTTTGAACAGAAGATTGG -3'
(R):5'- AGCTACGTTTCTAGTACCAACGGTG -3'
Posted On 2021-08-31