Incidental Mutation 'R8963:Large1'
ID 682493
Institutional Source Beutler Lab
Gene Symbol Large1
Ensembl Gene ENSMUSG00000004383
Gene Name LARGE xylosyl- and glucuronyltransferase 1
Synonyms froggy, BPFD#36, fg, enr
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.588) question?
Stock # R8963 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 72814599-73353540 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 72815984 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 704 (I704N)
Ref Sequence ENSEMBL: ENSMUSP00000148336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004497] [ENSMUST00000119826] [ENSMUST00000212459]
AlphaFold Q9Z1M7
Predicted Effect probably damaging
Transcript: ENSMUST00000004497
AA Change: I704N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000004497
Gene: ENSMUSG00000004383
AA Change: I704N

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
coiled coil region 55 90 N/A INTRINSIC
Pfam:Glyco_transf_8 141 387 6.2e-22 PFAM
Pfam:Glyco_transf_49 473 540 5.2e-15 PFAM
Pfam:Glyco_transf_49 535 743 1.1e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119826
AA Change: I704N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112617
Gene: ENSMUSG00000004383
AA Change: I704N

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
coiled coil region 55 90 N/A INTRINSIC
Pfam:Glyco_transf_8 142 386 3e-23 PFAM
Pfam:Glyco_transf_49 473 540 2.3e-11 PFAM
Pfam:Glyco_transf_49 520 743 2.7e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212459
AA Change: I704N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is one of the largest in the human genome, encodes a member of the N-acetylglucosaminyltransferase gene family. It encodes a glycosyltransferase which participates in glycosylation of alpha-dystroglycan, and may carry out the synthesis of glycoprotein and glycosphingolipid sugar chains. It may also be involved in the addition of a repeated disaccharide unit. Mutations in this gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Alternative splicing of this gene results in two transcript variants that encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes exhibit a progressive myopathy, abnormal posture, thoracic kyphosis, calcium deposits in muscle, loss of Schwann cells and myelin, eye and CNS defects, deafness, reduced growth, and death around 4 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T A 5: 9,437,792 N559K probably damaging Het
Aatk T C 11: 120,012,137 T421A probably damaging Het
Adamts12 T C 15: 11,317,357 probably null Het
Adgrv1 A T 13: 81,419,469 V5195E probably benign Het
Adora2b C T 11: 62,249,157 A19V possibly damaging Het
Ankrd28 A G 14: 31,755,741 C115R probably benign Het
Ankrd35 T A 3: 96,679,687 L106* probably null Het
Ankrd44 G A 1: 54,762,379 A263V probably damaging Het
Apol7b T C 15: 77,423,920 K125R possibly damaging Het
BC005561 T C 5: 104,517,786 V58A probably benign Het
Cacna1c A T 6: 118,742,271 L245* probably null Het
Cbll1 A T 12: 31,488,200 H185Q probably damaging Het
Ccdc150 A C 1: 54,272,482 N209T probably benign Het
Ccdc88a T A 11: 29,498,416 N1465K possibly damaging Het
Cfap54 C A 10: 93,028,700 G124* probably null Het
Chml A T 1: 175,687,035 L440H probably damaging Het
Chrnd A T 1: 87,194,881 Q128L probably damaging Het
Clvs2 A T 10: 33,622,681 D84E probably benign Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Cyp2c40 T A 19: 39,767,482 I463F possibly damaging Het
Cyp51 C A 5: 4,086,519 R425L probably damaging Het
Daam1 A G 12: 71,945,244 T279A unknown Het
Ebf2 G T 14: 67,428,105 V571F probably benign Het
Elavl4 A T 4: 110,206,579 I275N probably damaging Het
F11r A G 1: 171,460,937 Q116R probably benign Het
Foxred2 T A 15: 77,945,605 D580V probably benign Het
Gatad1 A C 5: 3,641,544 L4R probably damaging Het
Gcn1l1 T A 5: 115,589,094 M670K probably benign Het
Greb1 A T 12: 16,724,884 F171I probably damaging Het
Grin2b A G 6: 136,044,009 V98A probably damaging Het
Helz2 A T 2: 181,229,614 V2735E probably damaging Het
Hrct1 A T 4: 43,727,564 probably benign Het
Ighv1-11 C T 12: 114,612,244 R117K probably damaging Het
Igkv12-46 A T 6: 69,764,770 S34T probably damaging Het
Il27ra T A 8: 84,041,082 N71Y probably damaging Het
Iqca G T 1: 90,139,927 H201N probably benign Het
Itgb1bp1 C T 12: 21,274,863 R64Q probably damaging Het
Katnb1 T C 8: 95,082,891 L13S probably damaging Het
Kif26b G A 1: 178,916,149 R1270Q probably benign Het
Klhdc2 A T 12: 69,300,291 R77* probably null Het
Klra10 A T 6: 130,272,654 probably null Het
Lrp1b G A 2: 40,998,184 H2241Y probably benign Het
Lrpap1 T A 5: 35,097,657 M212L probably benign Het
Mab21l1 A G 3: 55,782,927 probably benign Het
Map4k4 A T 1: 40,000,580 Q44L probably damaging Het
Map7d1 A G 4: 126,236,682 S412P probably damaging Het
Me1 A T 9: 86,598,791 F354I probably damaging Het
Nlrp1b A G 11: 71,217,832 V281A probably damaging Het
Nrip2 A G 6: 128,408,325 T240A possibly damaging Het
Nsmaf A G 4: 6,428,471 V203A probably damaging Het
Olfr1120 T A 2: 87,357,606 I54K possibly damaging Het
Olfr1284 A T 2: 111,379,300 Q100L probably damaging Het
Olfr229 A G 9: 39,910,199 Y132C probably damaging Het
Olfr722 A T 14: 49,895,052 M250K probably benign Het
P4ha2 T C 11: 54,114,169 F124L probably benign Het
Pcdha9 A T 18: 36,998,697 D273V probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plxnd1 G T 6: 115,972,545 S760* probably null Het
Polr1b A G 2: 129,115,656 T544A probably benign Het
Polr2g T C 19: 8,794,149 D153G probably damaging Het
Pramef8 T C 4: 143,417,659 Y192H probably benign Het
Rad51ap2 A C 12: 11,456,254 E59A possibly damaging Het
Rrm1 A T 7: 102,456,532 Y285F probably benign Het
Ryr3 A G 2: 112,836,670 probably null Het
Scaf4 GGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTG 16: 90,229,857 probably benign Het
Sftpd A G 14: 41,183,044 V30A probably benign Het
Sirt6 A G 10: 81,626,544 V7A probably benign Het
Ska1 C T 18: 74,197,568 V188M probably damaging Het
Skint8 G A 4: 111,937,044 M210I probably benign Het
Slc6a11 A G 6: 114,225,821 probably null Het
Slc6a2 A T 8: 92,989,074 H280L probably benign Het
Sptan1 T C 2: 29,983,732 V208A possibly damaging Het
Taf6l T A 19: 8,774,771 T518S probably benign Het
Tsc22d1 T C 14: 76,418,826 M59T probably benign Het
Unc5cl A G 17: 48,462,333 T282A probably benign Het
Vav3 A G 3: 109,682,913 K260E probably damaging Het
Vmn2r53 A G 7: 12,581,999 V631A probably damaging Het
Zfp938 A T 10: 82,225,453 F444L possibly damaging Het
Other mutations in Large1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Large1 APN 8 72837497 missense probably damaging 1.00
IGL00326:Large1 APN 8 73131983 missense probably benign
IGL00418:Large1 APN 8 72823841 critical splice acceptor site probably null
IGL01155:Large1 APN 8 73131989 missense probably benign 0.01
IGL01793:Large1 APN 8 72859181 splice site probably benign
IGL01929:Large1 APN 8 72859275 missense probably damaging 1.00
IGL02218:Large1 APN 8 72912122 missense probably damaging 1.00
IGL02276:Large1 APN 8 72818093 missense probably benign 0.00
IGL02329:Large1 APN 8 73048317 missense possibly damaging 0.80
IGL02543:Large1 APN 8 73048414 missense probably benign 0.00
IGL02887:Large1 APN 8 73132039 missense probably benign 0.07
biggs UTSW 8 73116419 missense probably damaging 1.00
umber UTSW 8 72883264 nonsense probably null
R0179:Large1 UTSW 8 73098846 missense probably benign 0.09
R0477:Large1 UTSW 8 72818082 missense probably damaging 1.00
R0587:Large1 UTSW 8 72859333 missense probably damaging 1.00
R0791:Large1 UTSW 8 73048479 splice site probably benign
R1253:Large1 UTSW 8 73048422 missense probably damaging 0.98
R1695:Large1 UTSW 8 72818082 missense probably damaging 1.00
R2017:Large1 UTSW 8 72852197 missense probably damaging 1.00
R4835:Large1 UTSW 8 73048347 missense probably damaging 1.00
R5105:Large1 UTSW 8 72852244 nonsense probably null
R5120:Large1 UTSW 8 72859341 missense probably damaging 1.00
R5135:Large1 UTSW 8 72818096 missense probably benign 0.38
R5137:Large1 UTSW 8 73048309 missense possibly damaging 0.58
R5567:Large1 UTSW 8 72837453 missense possibly damaging 0.93
R5945:Large1 UTSW 8 72852200 missense probably damaging 0.99
R6619:Large1 UTSW 8 72883264 nonsense probably null
R6951:Large1 UTSW 8 73116419 missense probably damaging 1.00
R7041:Large1 UTSW 8 73116464 missense probably damaging 0.98
R7300:Large1 UTSW 8 72837596 missense probably damaging 1.00
R7493:Large1 UTSW 8 72823715 missense probably benign 0.23
R7877:Large1 UTSW 8 73116443 missense probably damaging 1.00
R8118:Large1 UTSW 8 73131944 missense probably benign 0.40
R8129:Large1 UTSW 8 72815957 missense probably damaging 1.00
R8525:Large1 UTSW 8 72837492 missense probably damaging 1.00
R9170:Large1 UTSW 8 72816017 missense probably benign 0.00
Z1088:Large1 UTSW 8 72912103 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTTTGTCTTCAAAGGCTGGGC -3'
(R):5'- ACCCTGAAGCGAGTTATTCTG -3'

Sequencing Primer
(F):5'- CCTAGTGGTGGCTCTCCCTAGTAG -3'
(R):5'- AAGCGAGTTATTCTGGAGCTATTG -3'
Posted On 2021-08-31