Incidental Mutation 'R0735:St3gal1'
ID68251
Institutional Source Beutler Lab
Gene Symbol St3gal1
Ensembl Gene ENSMUSG00000013846
Gene NameST3 beta-galactoside alpha-2,3-sialyltransferase 1
SynonymsSiat4a, CMP-N-acetylneuraminate: [beta-galactosidase alpha-2,3] sialytransferase, ST3GalI, Siat4
MMRRC Submission 038916-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R0735 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location67102875-67176830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 67113687 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 39 (M39I)
Ref Sequence ENSEMBL: ENSMUSP00000155359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092640] [ENSMUST00000229028] [ENSMUST00000229213]
Predicted Effect probably benign
Transcript: ENSMUST00000092640
AA Change: M39I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090307
Gene: ENSMUSG00000013846
AA Change: M39I

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Glyco_transf_29 80 336 1.7e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229028
AA Change: M39I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000229213
AA Change: M39I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230150
Meta Mutation Damage Score 0.0648 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.7%
  • 20x: 91.8%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The encoded protein is normally found in the Golgi but can be proteolytically processed to a soluble form. Correct glycosylation of the encoded protein may be critical to its sialyltransferase activity. This protein, which is a member of glycosyltransferase family 29, can use the same acceptor substrates as does sialyltransferase 4B. Two transcript variants encoding the same protein have been found for this gene. Other transcript variants may exist, but have not been fully characterized yet. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in altered terminal glycosylation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,717,638 I1552K possibly damaging Het
Actr8 T A 14: 29,989,712 M405K probably benign Het
Adam10 G A 9: 70,748,251 V334I possibly damaging Het
Adgra2 G T 8: 27,117,318 G686C probably damaging Het
Akap11 A T 14: 78,510,078 I1623N probably damaging Het
Astn1 A T 1: 158,472,389 T100S possibly damaging Het
B3galt1 A C 2: 68,118,579 I213L possibly damaging Het
B4galnt4 A G 7: 141,064,323 K101E probably benign Het
Camsap2 A G 1: 136,292,888 S324P probably damaging Het
Chrnb4 A G 9: 55,043,800 S60P probably damaging Het
Cpne1 A G 2: 156,078,750 probably null Het
Cubn G A 2: 13,491,689 probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cxcl15 T C 5: 90,801,294 M106T probably benign Het
Cyp2c23 A T 19: 44,016,810 M140K probably damaging Het
Dgke A G 11: 89,060,075 F104S probably benign Het
Dhx36 T A 3: 62,472,729 M849L probably benign Het
Dnah7a C T 1: 53,544,511 E1522K possibly damaging Het
Edil3 G T 13: 89,177,178 V219F probably damaging Het
Egln1 A G 8: 124,948,495 V187A possibly damaging Het
Fam193a T C 5: 34,439,378 I455T possibly damaging Het
Fdft1 A T 14: 63,163,420 I88N probably damaging Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Frs2 T A 10: 117,074,582 S292C probably damaging Het
Gm15448 T C 7: 3,821,782 T533A possibly damaging Het
Gpr107 T A 2: 31,171,994 F145I probably benign Het
Gpr153 T A 4: 152,279,373 C83* probably null Het
H2-Q7 T G 17: 35,440,186 probably null Het
Hsp90b1 A T 10: 86,695,748 probably benign Het
Kcnk1 C A 8: 126,025,289 N211K probably damaging Het
Klb T C 5: 65,379,727 V800A probably benign Het
Lat2 T C 5: 134,606,783 Y59C probably damaging Het
Mlkl A T 8: 111,327,801 probably benign Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mtbp T A 15: 55,562,942 C93* probably null Het
Myo7a A G 7: 98,081,180 probably benign Het
Myt1 G A 2: 181,807,387 probably benign Het
Ogfrl1 T C 1: 23,375,754 Q224R possibly damaging Het
Olfr418 A G 1: 173,271,002 T276A probably benign Het
Olfr661 A T 7: 104,688,819 H268L probably damaging Het
Osbpl2 A G 2: 180,150,290 probably benign Het
Plb1 C T 5: 32,284,920 T252M possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbsn T C 6: 92,189,693 T657A probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rps6kb2 C A 19: 4,157,883 S348I probably benign Het
Rsrp1 C T 4: 134,924,257 R111W unknown Het
Ryr3 T C 2: 112,732,982 T2933A probably benign Het
Scara5 A G 14: 65,731,019 D247G possibly damaging Het
Slc7a11 C T 3: 50,424,096 S231N probably benign Het
Sod2 A T 17: 13,010,564 N91Y probably damaging Het
Spesp1 A T 9: 62,272,685 S314T probably benign Het
Stat6 A T 10: 127,658,241 I646F probably damaging Het
Tdrd1 A T 19: 56,865,978 K1119* probably null Het
Thbs2 A G 17: 14,679,815 I600T probably benign Het
Tor1a A G 2: 30,963,838 V160A probably damaging Het
Trdmt1 T G 2: 13,523,438 D104A probably benign Het
Trim58 T C 11: 58,651,393 V393A probably benign Het
Trip4 C T 9: 65,884,918 probably benign Het
Trip6 T C 5: 137,310,821 E341G probably benign Het
Ttn T A 2: 76,715,195 I32595F probably damaging Het
Ubr4 T A 4: 139,428,028 probably null Het
Ush2a G A 1: 188,864,693 V3877I probably benign Het
Vmn1r29 G T 6: 58,307,732 G146C probably damaging Het
Vmn2r53 A G 7: 12,581,780 V704A probably benign Het
Vmn2r7 C T 3: 64,716,367 M268I probably benign Het
Wnt7b G A 15: 85,537,495 T248M probably damaging Het
Xab2 G A 8: 3,613,649 P394S possibly damaging Het
Zfp663 A G 2: 165,359,075 V13A probably damaging Het
Other mutations in St3gal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:St3gal1 APN 15 67112617 missense probably benign 0.03
Benelux UTSW 15 67113785 nonsense probably null
Luxembourg UTSW 15 67111346 missense possibly damaging 0.52
Strasbourg UTSW 15 67106673 missense probably damaging 0.99
R0452:St3gal1 UTSW 15 67109655 splice site probably benign
R0478:St3gal1 UTSW 15 67113730 missense probably damaging 1.00
R2357:St3gal1 UTSW 15 67113782 missense probably benign 0.01
R5061:St3gal1 UTSW 15 67108229 missense probably benign 0.40
R5199:St3gal1 UTSW 15 67113715 missense probably benign 0.00
R5734:St3gal1 UTSW 15 67106673 missense probably damaging 0.99
R5828:St3gal1 UTSW 15 67113785 nonsense probably null
R6370:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6371:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6373:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6385:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6387:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6388:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6417:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6420:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6421:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6462:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6463:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6469:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6473:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6474:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6759:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6760:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6894:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6963:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R7250:St3gal1 UTSW 15 67106729 missense possibly damaging 0.89
R7394:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R7588:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R7590:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R7591:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R7860:St3gal1 UTSW 15 67111265 missense probably benign 0.38
R7943:St3gal1 UTSW 15 67111265 missense probably benign 0.38
Z1177:St3gal1 UTSW 15 67111367 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TATGTGTCCTCCTCCATCAGAGCG -3'
(R):5'- TGTGCCACACAGCAATGTCGAG -3'

Sequencing Primer
(F):5'- TCCATCAGAGCGTTGTGGAC -3'
(R):5'- TCCAACAGGCTGAAGTTTGC -3'
Posted On2013-09-03