Incidental Mutation 'R0735:Wnt7b'
ID68252
Institutional Source Beutler Lab
Gene Symbol Wnt7b
Ensembl Gene ENSMUSG00000022382
Gene Namewingless-type MMTV integration site family, member 7B
SynonymsWnt-7b
MMRRC Submission 038916-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0735 (G1)
Quality Score189
Status Validated
Chromosome15
Chromosomal Location85535437-85582473 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85537495 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 248 (T248M)
Ref Sequence ENSEMBL: ENSMUSP00000155817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023015] [ENSMUST00000109424] [ENSMUST00000167968] [ENSMUST00000229191] [ENSMUST00000229495]
Predicted Effect probably damaging
Transcript: ENSMUST00000023015
AA Change: T322M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023015
Gene: ENSMUSG00000022382
AA Change: T322M

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
WNT1 40 349 1.29e-214 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109424
AA Change: T315M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105051
Gene: ENSMUSG00000022382
AA Change: T315M

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
WNT1 44 353 1.29e-214 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167968
AA Change: T248M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130627
Gene: ENSMUSG00000022382
AA Change: T248M

DomainStartEndE-ValueType
WNT1 1 282 1.21e-182 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000229191
AA Change: T319M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000229495
AA Change: T248M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.7%
  • 20x: 91.8%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the WNT gene family, which consists of structurally related genes that encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. Among members of the human WNT family, this gene product is most similar to WNT7A protein. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null embryos die at midgestational stages due to placental abnormalities involving the fusion of the chorion and allantois. Mice homozygous for a truncated allele display neonatal lethality, respiratory failure, and lung hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,717,638 I1552K possibly damaging Het
Actr8 T A 14: 29,989,712 M405K probably benign Het
Adam10 G A 9: 70,748,251 V334I possibly damaging Het
Adgra2 G T 8: 27,117,318 G686C probably damaging Het
Akap11 A T 14: 78,510,078 I1623N probably damaging Het
Astn1 A T 1: 158,472,389 T100S possibly damaging Het
B3galt1 A C 2: 68,118,579 I213L possibly damaging Het
B4galnt4 A G 7: 141,064,323 K101E probably benign Het
Camsap2 A G 1: 136,292,888 S324P probably damaging Het
Chrnb4 A G 9: 55,043,800 S60P probably damaging Het
Cpne1 A G 2: 156,078,750 probably null Het
Cubn G A 2: 13,491,689 probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cxcl15 T C 5: 90,801,294 M106T probably benign Het
Cyp2c23 A T 19: 44,016,810 M140K probably damaging Het
Dgke A G 11: 89,060,075 F104S probably benign Het
Dhx36 T A 3: 62,472,729 M849L probably benign Het
Dnah7a C T 1: 53,544,511 E1522K possibly damaging Het
Edil3 G T 13: 89,177,178 V219F probably damaging Het
Egln1 A G 8: 124,948,495 V187A possibly damaging Het
Fam193a T C 5: 34,439,378 I455T possibly damaging Het
Fdft1 A T 14: 63,163,420 I88N probably damaging Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Frs2 T A 10: 117,074,582 S292C probably damaging Het
Gm15448 T C 7: 3,821,782 T533A possibly damaging Het
Gpr107 T A 2: 31,171,994 F145I probably benign Het
Gpr153 T A 4: 152,279,373 C83* probably null Het
H2-Q7 T G 17: 35,440,186 probably null Het
Hsp90b1 A T 10: 86,695,748 probably benign Het
Kcnk1 C A 8: 126,025,289 N211K probably damaging Het
Klb T C 5: 65,379,727 V800A probably benign Het
Lat2 T C 5: 134,606,783 Y59C probably damaging Het
Mlkl A T 8: 111,327,801 probably benign Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mtbp T A 15: 55,562,942 C93* probably null Het
Myo7a A G 7: 98,081,180 probably benign Het
Myt1 G A 2: 181,807,387 probably benign Het
Ogfrl1 T C 1: 23,375,754 Q224R possibly damaging Het
Olfr418 A G 1: 173,271,002 T276A probably benign Het
Olfr661 A T 7: 104,688,819 H268L probably damaging Het
Osbpl2 A G 2: 180,150,290 probably benign Het
Plb1 C T 5: 32,284,920 T252M possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbsn T C 6: 92,189,693 T657A probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rps6kb2 C A 19: 4,157,883 S348I probably benign Het
Rsrp1 C T 4: 134,924,257 R111W unknown Het
Ryr3 T C 2: 112,732,982 T2933A probably benign Het
Scara5 A G 14: 65,731,019 D247G possibly damaging Het
Slc7a11 C T 3: 50,424,096 S231N probably benign Het
Sod2 A T 17: 13,010,564 N91Y probably damaging Het
Spesp1 A T 9: 62,272,685 S314T probably benign Het
St3gal1 C A 15: 67,113,687 M39I probably benign Het
Stat6 A T 10: 127,658,241 I646F probably damaging Het
Tdrd1 A T 19: 56,865,978 K1119* probably null Het
Thbs2 A G 17: 14,679,815 I600T probably benign Het
Tor1a A G 2: 30,963,838 V160A probably damaging Het
Trdmt1 T G 2: 13,523,438 D104A probably benign Het
Trim58 T C 11: 58,651,393 V393A probably benign Het
Trip4 C T 9: 65,884,918 probably benign Het
Trip6 T C 5: 137,310,821 E341G probably benign Het
Ttn T A 2: 76,715,195 I32595F probably damaging Het
Ubr4 T A 4: 139,428,028 probably null Het
Ush2a G A 1: 188,864,693 V3877I probably benign Het
Vmn1r29 G T 6: 58,307,732 G146C probably damaging Het
Vmn2r53 A G 7: 12,581,780 V704A probably benign Het
Vmn2r7 C T 3: 64,716,367 M268I probably benign Het
Xab2 G A 8: 3,613,649 P394S possibly damaging Het
Zfp663 A G 2: 165,359,075 V13A probably damaging Het
Other mutations in Wnt7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02543:Wnt7b APN 15 85558896 splice site probably benign
R0243:Wnt7b UTSW 15 85558902 critical splice donor site probably null
R0835:Wnt7b UTSW 15 85537777 missense probably damaging 1.00
R1917:Wnt7b UTSW 15 85559080 missense probably damaging 1.00
R1919:Wnt7b UTSW 15 85559080 missense probably damaging 1.00
R3914:Wnt7b UTSW 15 85537858 missense possibly damaging 0.90
R5893:Wnt7b UTSW 15 85581374 intron probably benign
R7483:Wnt7b UTSW 15 85537414 missense possibly damaging 0.95
R7498:Wnt7b UTSW 15 85543679 missense probably damaging 1.00
R7787:Wnt7b UTSW 15 85543911 missense probably damaging 0.99
Z1177:Wnt7b UTSW 15 85559069 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCAGACCACCATTGCGTTGACC -3'
(R):5'- TACCAGAAGCCTATGGAGACGGAC -3'

Sequencing Primer
(F):5'- AGGAGCCTGGAGTATCTCG -3'
(R):5'- CTATGGAGACGGACCTGGTG -3'
Posted On2013-09-03