Incidental Mutation 'R0735:Thbs2'
ID68254
Institutional Source Beutler Lab
Gene Symbol Thbs2
Ensembl Gene ENSMUSG00000023885
Gene Namethrombospondin 2
SynonymsThbs-2, Thrombospondin-2, TSP2
MMRRC Submission 038916-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R0735 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location14665500-14694235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14679815 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 600 (I600T)
Ref Sequence ENSEMBL: ENSMUSP00000128308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170872]
Predicted Effect probably benign
Transcript: ENSMUST00000170872
AA Change: I600T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000128308
Gene: ENSMUSG00000023885
AA Change: I600T

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
TSPN 21 215 3.8e-60 SMART
VWC 320 374 3.55e-19 SMART
TSP1 384 431 3.36e-11 SMART
TSP1 440 492 1.35e-15 SMART
TSP1 497 549 8.6e-18 SMART
EGF 552 589 6.3e-3 SMART
EGF 593 647 1.56e1 SMART
EGF 651 692 2.19e-2 SMART
Pfam:TSP_3 729 764 2.5e-12 PFAM
Pfam:TSP_3 763 787 7.4e-7 PFAM
Pfam:TSP_3 788 823 9.4e-12 PFAM
Pfam:TSP_3 823 846 4.1e-7 PFAM
Pfam:TSP_3 847 884 1.7e-12 PFAM
Pfam:TSP_3 885 920 1.3e-11 PFAM
Pfam:TSP_3 921 956 3.1e-11 PFAM
Pfam:TSP_C 974 1171 1e-98 PFAM
Meta Mutation Damage Score 0.1099 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.7%
  • 20x: 91.8%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin family. It is a disulfide-linked homotrimeric glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein has been shown to function as a potent inhibitor of tumor growth and angiogenesis. Studies of the mouse counterpart suggest that this protein may modulate the cell surface properties of mesenchymal cells and be involved in cell adhesion and migration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display premature death, abnormal tails, marked structural and functional abnormalities in a variety of connective tissues including skin, tendon, bone, and blood vessels, accelerated wound healing, and enhanced susceptibility to experimental skin tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,717,638 I1552K possibly damaging Het
Actr8 T A 14: 29,989,712 M405K probably benign Het
Adam10 G A 9: 70,748,251 V334I possibly damaging Het
Adgra2 G T 8: 27,117,318 G686C probably damaging Het
Akap11 A T 14: 78,510,078 I1623N probably damaging Het
Astn1 A T 1: 158,472,389 T100S possibly damaging Het
B3galt1 A C 2: 68,118,579 I213L possibly damaging Het
B4galnt4 A G 7: 141,064,323 K101E probably benign Het
Camsap2 A G 1: 136,292,888 S324P probably damaging Het
Chrnb4 A G 9: 55,043,800 S60P probably damaging Het
Cpne1 A G 2: 156,078,750 probably null Het
Cubn G A 2: 13,491,689 probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cxcl15 T C 5: 90,801,294 M106T probably benign Het
Cyp2c23 A T 19: 44,016,810 M140K probably damaging Het
Dgke A G 11: 89,060,075 F104S probably benign Het
Dhx36 T A 3: 62,472,729 M849L probably benign Het
Dnah7a C T 1: 53,544,511 E1522K possibly damaging Het
Edil3 G T 13: 89,177,178 V219F probably damaging Het
Egln1 A G 8: 124,948,495 V187A possibly damaging Het
Fam193a T C 5: 34,439,378 I455T possibly damaging Het
Fdft1 A T 14: 63,163,420 I88N probably damaging Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Frs2 T A 10: 117,074,582 S292C probably damaging Het
Gm15448 T C 7: 3,821,782 T533A possibly damaging Het
Gpr107 T A 2: 31,171,994 F145I probably benign Het
Gpr153 T A 4: 152,279,373 C83* probably null Het
H2-Q7 T G 17: 35,440,186 probably null Het
Hsp90b1 A T 10: 86,695,748 probably benign Het
Kcnk1 C A 8: 126,025,289 N211K probably damaging Het
Klb T C 5: 65,379,727 V800A probably benign Het
Lat2 T C 5: 134,606,783 Y59C probably damaging Het
Mlkl A T 8: 111,327,801 probably benign Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mtbp T A 15: 55,562,942 C93* probably null Het
Myo7a A G 7: 98,081,180 probably benign Het
Myt1 G A 2: 181,807,387 probably benign Het
Ogfrl1 T C 1: 23,375,754 Q224R possibly damaging Het
Olfr418 A G 1: 173,271,002 T276A probably benign Het
Olfr661 A T 7: 104,688,819 H268L probably damaging Het
Osbpl2 A G 2: 180,150,290 probably benign Het
Plb1 C T 5: 32,284,920 T252M possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbsn T C 6: 92,189,693 T657A probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rps6kb2 C A 19: 4,157,883 S348I probably benign Het
Rsrp1 C T 4: 134,924,257 R111W unknown Het
Ryr3 T C 2: 112,732,982 T2933A probably benign Het
Scara5 A G 14: 65,731,019 D247G possibly damaging Het
Slc7a11 C T 3: 50,424,096 S231N probably benign Het
Sod2 A T 17: 13,010,564 N91Y probably damaging Het
Spesp1 A T 9: 62,272,685 S314T probably benign Het
St3gal1 C A 15: 67,113,687 M39I probably benign Het
Stat6 A T 10: 127,658,241 I646F probably damaging Het
Tdrd1 A T 19: 56,865,978 K1119* probably null Het
Tor1a A G 2: 30,963,838 V160A probably damaging Het
Trdmt1 T G 2: 13,523,438 D104A probably benign Het
Trim58 T C 11: 58,651,393 V393A probably benign Het
Trip4 C T 9: 65,884,918 probably benign Het
Trip6 T C 5: 137,310,821 E341G probably benign Het
Ttn T A 2: 76,715,195 I32595F probably damaging Het
Ubr4 T A 4: 139,428,028 probably null Het
Ush2a G A 1: 188,864,693 V3877I probably benign Het
Vmn1r29 G T 6: 58,307,732 G146C probably damaging Het
Vmn2r53 A G 7: 12,581,780 V704A probably benign Het
Vmn2r7 C T 3: 64,716,367 M268I probably benign Het
Wnt7b G A 15: 85,537,495 T248M probably damaging Het
Xab2 G A 8: 3,613,649 P394S possibly damaging Het
Zfp663 A G 2: 165,359,075 V13A probably damaging Het
Other mutations in Thbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Thbs2 APN 17 14668835 missense probably damaging 1.00
IGL00764:Thbs2 APN 17 14690252 missense probably damaging 0.98
IGL01370:Thbs2 APN 17 14690065 missense possibly damaging 0.82
IGL01604:Thbs2 APN 17 14678769 missense probably benign 0.31
IGL01936:Thbs2 APN 17 14687814 missense probably benign 0.00
IGL02061:Thbs2 APN 17 14679914 missense probably benign 0.35
IGL02255:Thbs2 APN 17 14689785 missense probably benign 0.00
IGL02342:Thbs2 APN 17 14676316 missense probably damaging 1.00
IGL02402:Thbs2 APN 17 14671454 missense probably benign 0.01
IGL02499:Thbs2 APN 17 14684066 splice site probably benign
IGL02572:Thbs2 APN 17 14677013 missense possibly damaging 0.72
IGL02701:Thbs2 APN 17 14683361 missense probably benign 0.05
IGL02871:Thbs2 APN 17 14685786 missense probably benign
IGL03058:Thbs2 APN 17 14689969 missense possibly damaging 0.91
IGL03185:Thbs2 APN 17 14681410 nonsense probably null
IGL03232:Thbs2 APN 17 14691413 start codon destroyed probably null
IGL03289:Thbs2 APN 17 14690122 missense probably benign 0.00
IGL03407:Thbs2 APN 17 14673273 missense probably benign 0.00
H8562:Thbs2 UTSW 17 14671453 missense probably benign 0.00
IGL02802:Thbs2 UTSW 17 14684127 missense probably benign 0.01
PIT4354001:Thbs2 UTSW 17 14689968 missense probably damaging 0.99
R0088:Thbs2 UTSW 17 14681701 missense possibly damaging 0.96
R0167:Thbs2 UTSW 17 14667525 splice site probably benign
R0415:Thbs2 UTSW 17 14679973 missense probably benign
R0658:Thbs2 UTSW 17 14680325 missense probably benign 0.00
R1582:Thbs2 UTSW 17 14671288 missense probably damaging 1.00
R1585:Thbs2 UTSW 17 14689768 missense probably benign 0.00
R1608:Thbs2 UTSW 17 14685781 missense probably benign
R1721:Thbs2 UTSW 17 14678810 missense probably benign 0.00
R1724:Thbs2 UTSW 17 14685900 missense possibly damaging 0.80
R1791:Thbs2 UTSW 17 14685813 missense probably benign
R1816:Thbs2 UTSW 17 14670713 missense probably benign 0.01
R1816:Thbs2 UTSW 17 14670714 missense probably benign 0.00
R1911:Thbs2 UTSW 17 14689842 missense probably benign 0.38
R2137:Thbs2 UTSW 17 14673306 missense probably damaging 1.00
R2152:Thbs2 UTSW 17 14673209 missense probably damaging 1.00
R2244:Thbs2 UTSW 17 14671413 missense probably damaging 1.00
R2325:Thbs2 UTSW 17 14690289 splice site probably null
R2509:Thbs2 UTSW 17 14685843 missense probably benign 0.11
R3838:Thbs2 UTSW 17 14687851 missense probably benign
R4173:Thbs2 UTSW 17 14681631 intron probably null
R4427:Thbs2 UTSW 17 14680335 missense probably benign
R4495:Thbs2 UTSW 17 14671413 missense probably damaging 1.00
R4789:Thbs2 UTSW 17 14671488 missense probably damaging 1.00
R4928:Thbs2 UTSW 17 14678900 missense probably damaging 1.00
R5058:Thbs2 UTSW 17 14676329 missense probably damaging 1.00
R5112:Thbs2 UTSW 17 14670590 splice site probably null
R5619:Thbs2 UTSW 17 14681244 missense probably damaging 1.00
R5649:Thbs2 UTSW 17 14689953 missense probably damaging 1.00
R5664:Thbs2 UTSW 17 14689837 missense probably damaging 1.00
R5801:Thbs2 UTSW 17 14687863 missense probably damaging 1.00
R5816:Thbs2 UTSW 17 14684071 critical splice donor site probably null
R5840:Thbs2 UTSW 17 14681430 splice site probably null
R6149:Thbs2 UTSW 17 14679680 critical splice donor site probably null
R6166:Thbs2 UTSW 17 14680388 missense probably damaging 1.00
R6412:Thbs2 UTSW 17 14677077 missense probably damaging 1.00
R6473:Thbs2 UTSW 17 14685796 missense probably benign 0.23
R6640:Thbs2 UTSW 17 14673368 missense possibly damaging 0.94
R6695:Thbs2 UTSW 17 14674164 missense possibly damaging 0.54
R6711:Thbs2 UTSW 17 14690265 missense probably benign 0.00
R6947:Thbs2 UTSW 17 14689767 missense possibly damaging 0.79
R6962:Thbs2 UTSW 17 14681820 missense probably benign 0.00
R7183:Thbs2 UTSW 17 14690116 missense possibly damaging 0.90
R7203:Thbs2 UTSW 17 14671458 missense probably damaging 1.00
R7386:Thbs2 UTSW 17 14673150 missense possibly damaging 0.95
R7621:Thbs2 UTSW 17 14674164 missense probably benign
S24628:Thbs2 UTSW 17 14679973 missense probably benign
X0025:Thbs2 UTSW 17 14681800 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCCACTTGCCTAGACTTGGCAGAC -3'
(R):5'- GGGTGCTTATCCAACCCGTGTTTTC -3'

Sequencing Primer
(F):5'- TAGACTTGGCAGACTCTTTCAAGC -3'
(R):5'- TTCCTGGAGCCAAGTGCAAC -3'
Posted On2013-09-03