Incidental Mutation 'R8717:Adgrf3'
ID 682546
Institutional Source Beutler Lab
Gene Symbol Adgrf3
Ensembl Gene ENSMUSG00000067642
Gene Name adhesion G protein-coupled receptor F3
Synonyms Gpr113, LOC381628, PGR23
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8717 (G1)
Quality Score 206.009
Status Validated
Chromosome 5
Chromosomal Location 30193431-30205722 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) T to A at 30198581 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088117] [ENSMUST00000125367]
AlphaFold Q58Y75
Predicted Effect probably benign
Transcript: ENSMUST00000088117
SMART Domains Protein: ENSMUSP00000085440
Gene: ENSMUSG00000067642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
Blast:IG 163 252 2e-20 BLAST
Blast:CCP 341 399 1e-6 BLAST
low complexity region 403 415 N/A INTRINSIC
low complexity region 471 483 N/A INTRINSIC
GPS 632 684 2.68e-17 SMART
Pfam:7tm_2 687 935 1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125367
SMART Domains Protein: ENSMUSP00000120958
Gene: ENSMUSG00000067642

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik A G 9: 58,499,340 T178A probably damaging Het
A2ml1 A G 6: 128,566,995 F528L probably benign Het
Aadacl3 T G 4: 144,456,208 D230A probably damaging Het
Agtr1a A C 13: 30,381,374 T141P probably damaging Het
Ankfy1 T A 11: 72,730,474 D195E probably benign Het
AY074887 G A 9: 54,950,502 T113I probably damaging Het
Cacna1c G A 6: 119,057,353 A71V Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Cntrl T A 2: 35,113,339 V78E probably benign Het
Cyp2c67 T A 19: 39,638,711 Y225F probably benign Het
Cyp2j13 T A 4: 96,045,540 H369L probably benign Het
Dagla T C 19: 10,248,223 E859G probably benign Het
Duox1 C A 2: 122,337,671 S1092R possibly damaging Het
Elfn2 C A 15: 78,672,361 S662I probably benign Het
Epor A T 9: 21,959,445 C380S probably benign Het
Fam213a G A 14: 40,998,879 P126S possibly damaging Het
Fsd2 T C 7: 81,540,342 E564G probably benign Het
Hace1 C T 10: 45,605,598 T117I unknown Het
Ift172 A G 5: 31,255,641 M1488T probably benign Het
Kdm3b A G 18: 34,819,787 E1070G probably damaging Het
Lrp6 A G 6: 134,457,748 F1331L probably benign Het
Lrrc74a G A 12: 86,736,479 E33K probably damaging Het
Magel2 T C 7: 62,377,672 M108T unknown Het
Mief1 T C 15: 80,248,383 S127P probably benign Het
Mprip T C 11: 59,759,700 V1410A probably benign Het
Muc1 G A 3: 89,231,514 V477M possibly damaging Het
Nat8f3 A T 6: 85,761,705 M25K possibly damaging Het
Neb T G 2: 52,183,769 H5942P probably damaging Het
Nf2 A T 11: 4,816,099 Y144N probably damaging Het
Nipbl T A 15: 8,338,741 M1166L probably benign Het
Npnt A T 3: 132,908,375 L206Q probably damaging Het
Olfr1288 A G 2: 111,479,647 T288A probably damaging Het
Olfr1337 T C 4: 118,781,799 Y262C probably damaging Het
Olfr808 T A 10: 129,768,258 I254N probably damaging Het
Parg A G 14: 32,210,535 K444R probably benign Het
Pcbp4 A T 9: 106,460,003 probably null Het
Pcdhgb4 A G 18: 37,720,794 S81G probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plekho2 T C 9: 65,556,776 N264D probably benign Het
Pmpca T A 2: 26,391,881 M182K probably damaging Het
Prdm10 A G 9: 31,341,399 H476R probably benign Het
Rab7 T C 6: 88,012,387 S34G probably damaging Het
Rbp3 G A 14: 33,956,438 R781H probably damaging Het
Rngtt T A 4: 33,368,695 S409R probably damaging Het
Ryr1 C A 7: 29,052,328 R3680L probably benign Het
Sbno1 T C 5: 124,374,555 S1384G possibly damaging Het
Shmt1 T C 11: 60,794,937 D271G probably benign Het
Sin3a C T 9: 57,127,226 R1228W probably damaging Het
Slc25a39 T C 11: 102,403,794 R294G probably benign Het
Smcr8 T A 11: 60,779,428 S467R probably damaging Het
Spaca7 A G 8: 12,586,480 Y102C probably damaging Het
Tacr1 A G 6: 82,403,725 Y39C probably damaging Het
Tenm3 G A 8: 48,299,645 S894L possibly damaging Het
Tmem115 T A 9: 107,537,933 M307K possibly damaging Het
Tnn A G 1: 160,116,276 V989A possibly damaging Het
Trabd2b T A 4: 114,602,989 N441K probably damaging Het
Ttll1 T C 15: 83,489,508 K368R probably benign Het
Tubgcp2 C T 7: 139,996,792 V858I probably benign Het
Ufsp2 G T 8: 45,983,577 V122L probably benign Het
Wdr26 A G 1: 181,184,348 C470R possibly damaging Het
Xab2 T C 8: 3,613,845 H358R probably benign Het
Xrcc5 A G 1: 72,383,746 I697V probably benign Het
Other mutations in Adgrf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03080:Adgrf3 APN 5 30196829 missense probably benign 0.02
IGL03171:Adgrf3 APN 5 30196294 missense probably damaging 1.00
R0010:Adgrf3 UTSW 5 30205609 splice site probably benign
R0042:Adgrf3 UTSW 5 30197428 missense probably damaging 1.00
R0140:Adgrf3 UTSW 5 30196381 missense probably benign 0.19
R0617:Adgrf3 UTSW 5 30195080 missense probably benign 0.25
R0748:Adgrf3 UTSW 5 30196876 missense probably damaging 1.00
R1291:Adgrf3 UTSW 5 30199534 missense probably damaging 0.99
R1330:Adgrf3 UTSW 5 30195095 missense probably benign 0.24
R1468:Adgrf3 UTSW 5 30202229 splice site probably benign
R1695:Adgrf3 UTSW 5 30203555 missense probably benign 0.05
R1716:Adgrf3 UTSW 5 30197551 missense probably benign 0.03
R1844:Adgrf3 UTSW 5 30199213 missense probably damaging 0.96
R1935:Adgrf3 UTSW 5 30202306 missense probably benign 0.00
R1936:Adgrf3 UTSW 5 30202306 missense probably benign 0.00
R2059:Adgrf3 UTSW 5 30199491 missense possibly damaging 0.91
R2656:Adgrf3 UTSW 5 30196438 missense possibly damaging 0.96
R2913:Adgrf3 UTSW 5 30196994 missense probably damaging 1.00
R2914:Adgrf3 UTSW 5 30196994 missense probably damaging 1.00
R2987:Adgrf3 UTSW 5 30197360 missense probably damaging 1.00
R3797:Adgrf3 UTSW 5 30196823 missense possibly damaging 0.49
R3798:Adgrf3 UTSW 5 30196823 missense possibly damaging 0.49
R3799:Adgrf3 UTSW 5 30196823 missense possibly damaging 0.49
R3934:Adgrf3 UTSW 5 30200434 unclassified probably benign
R4043:Adgrf3 UTSW 5 30204362 missense probably benign 0.00
R4080:Adgrf3 UTSW 5 30197369 nonsense probably null
R4575:Adgrf3 UTSW 5 30202257 missense probably benign 0.00
R4754:Adgrf3 UTSW 5 30197617 critical splice acceptor site probably null
R4819:Adgrf3 UTSW 5 30198444 missense possibly damaging 0.66
R4893:Adgrf3 UTSW 5 30200478 missense probably benign 0.00
R4991:Adgrf3 UTSW 5 30199148 missense probably benign 0.26
R5686:Adgrf3 UTSW 5 30197306 missense probably damaging 1.00
R5965:Adgrf3 UTSW 5 30205639 missense probably benign 0.00
R5997:Adgrf3 UTSW 5 30198362 critical splice donor site probably null
R6103:Adgrf3 UTSW 5 30196267 missense probably damaging 1.00
R6244:Adgrf3 UTSW 5 30197533 missense probably benign 0.17
R6409:Adgrf3 UTSW 5 30197314 missense probably damaging 0.96
R6575:Adgrf3 UTSW 5 30196524 missense possibly damaging 0.72
R6745:Adgrf3 UTSW 5 30203603 missense probably benign 0.31
R6790:Adgrf3 UTSW 5 30196387 missense probably benign 0.00
R6813:Adgrf3 UTSW 5 30197521 missense probably damaging 0.96
R7202:Adgrf3 UTSW 5 30204380 nonsense probably null
R7250:Adgrf3 UTSW 5 30195682 missense probably damaging 1.00
R7353:Adgrf3 UTSW 5 30198497 missense probably damaging 0.98
R7634:Adgrf3 UTSW 5 30202247 missense probably benign 0.01
R7658:Adgrf3 UTSW 5 30197206 missense probably benign 0.41
R8037:Adgrf3 UTSW 5 30199512 missense probably damaging 1.00
R8281:Adgrf3 UTSW 5 30197303 missense possibly damaging 0.46
R8857:Adgrf3 UTSW 5 30197067 nonsense probably null
R8926:Adgrf3 UTSW 5 30200448 missense possibly damaging 0.46
R9391:Adgrf3 UTSW 5 30195073 missense possibly damaging 0.94
R9446:Adgrf3 UTSW 5 30196959 missense probably benign 0.01
R9522:Adgrf3 UTSW 5 30199484 missense possibly damaging 0.90
Z1088:Adgrf3 UTSW 5 30199120 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CCAGTAAGGTCACAGTGTGC -3'
(R):5'- TGCTGGAGGTCTCTAGAAAGG -3'

Sequencing Primer
(F):5'- GTGCAGCATTTCCCATAAGTCAGAG -3'
(R):5'- GAGTGTGAAAGTGGATCCTCC -3'
Posted On 2021-09-07