Mutagenetix > Incidental Mutation

Incidental Mutation 'R8708:Myo3a'

682550

Institutional Source

Beutler Lab

Gene Symbol

Myo3a

Ensembl Gene

ENSMUSG00000025716

Gene Name

myosin IIIA

Synonyms

9030416P08Rik

MMRRC Submission

068562-MU

Accession Numbers

Genbank: NM_148413; MGI: 2183924

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8708 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

22227503-22618252 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 22291796 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000120573 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044749] [ENSMUST00000153002]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000044749

SMART Domains

Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716

Domain	Start	End	E-Value	Type
S_TKc	29	295	1.62e-91	SMART
MYSc	340	1061	2.07e-252	SMART
IQ	1061	1083	2.88e1	SMART
IQ	1088	1110	9.48e-3	SMART
low complexity region	1153	1169	N/A	INTRINSIC
low complexity region	1359	1369	N/A	INTRINSIC
low complexity region	1496	1505	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000153002

SMART Domains

Protein: ENSMUSP00000120573
Gene: ENSMUSG00000025716

Domain	Start	End	E-Value	Type
S_TKc	21	287	1.62e-91	SMART
MYSc	332	753	3.06e-35	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

98% (99/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired hearing and cochlear hair cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adra1d	T	C	2: 131,561,480	K230R	probably damaging	Het
Akp3	T	A	1: 87,126,369	Y236*	probably null	Het
Alg11	T	C	8: 22,065,113	F130S	probably damaging	Het
Ankfn1	A	T	11: 89,503,930	S276R	possibly damaging	Het
Ankhd1	T	A	18: 36,594,291	H486Q	probably damaging	Het
Ankrd23	T	C	1: 36,534,088	T68A	probably benign	Het
Arhgap23	A	G	11: 97,452,412	T507A	probably benign	Het
Arid1a	A	T	4: 133,681,834	D1787E	unknown	Het
Atad2b	T	A	12: 4,961,253	D504E	probably damaging	Het
Atg2b	T	A	12: 105,669,428		probably benign	Het
Bptf	C	A	11: 107,073,313	S1685I	probably damaging	Het
Bptf	T	A	11: 107,073,314	S1685C	probably damaging	Het
Cacna1c	A	T	6: 118,627,455	I1437N		Het
Capn1	T	C	19: 6,011,298	K197E	probably damaging	Het
Ccdc177	T	C	12: 80,759,117	T128A	probably benign	Het
Ccdc7b	G	T	8: 129,136,614	M9I	probably benign	Het
Celf1	T	A	2: 91,010,580		probably null	Het
Ckap5	T	A	2: 91,595,478	N1285K	probably benign	Het
Col24a1	C	T	3: 145,545,265	T1673I	probably damaging	Het
Dbp	A	G	7: 45,709,801	E300G	probably damaging	Het
Dchs2	C	A	3: 83,128,742	H265Q	probably benign	Het
Dicer1	A	T	12: 104,728,445	S198T	possibly damaging	Het
Dnase1l2	A	T	17: 24,442,292	F86L	probably benign	Het
Dnhd1	T	G	7: 105,694,280	Y1610*	probably null	Het
Dock5	A	G	14: 67,767,371	V1529A	probably benign	Het
Egfr	G	T	11: 16,867,300		probably benign	Het
Exph5	T	A	9: 53,375,796	H1392Q	probably benign	Het
Fam78b	A	G	1: 167,078,763	K164E	possibly damaging	Het
Fignl2	C	A	15: 101,052,853	R516L	unknown	Het
Fndc7	C	T	3: 108,867,212	E577K	probably benign	Het
Fryl	T	C	5: 73,132,562	E107G	probably benign	Het
Gbp10	A	T	5: 105,220,965	M336K	probably damaging	Het
Gm11444	A	T	11: 85,846,897	C156S		Het
Gm6904	A	T	14: 59,244,813	C164S	probably damaging	Het
Gm996	C	A	2: 25,577,802	R699L	possibly damaging	Het
Golga3	C	A	5: 110,202,855	A752E	probably benign	Het
Gper1	G	T	5: 139,425,935	V12L	probably benign	Het
Hmbox1	G	T	14: 64,823,640	A394E	probably damaging	Het
Ighv1-71	T	A	12: 115,742,335	I77L	probably benign	Het
Ing4	A	T	6: 125,047,932	N214Y	probably damaging	Het
Ints8	A	G	4: 11,208,824		probably null	Het
Itpa	T	A	2: 130,675,719	V129E	probably damaging	Het
Itpripl1	T	A	2: 127,141,342	M287L	probably benign	Het
Klc3	T	C	7: 19,395,859	I362V	probably damaging	Het
Ky	T	A	9: 102,525,391		probably benign	Het
Lasp1	A	G	11: 97,806,883	N43S	possibly damaging	Het
Limk2	A	G	11: 3,350,763	M380T	probably benign	Het
Lrp2	T	A	2: 69,459,613	E3627D	probably damaging	Het
Lrrc25	T	C	8: 70,617,809	L80P	probably damaging	Het
Mcoln3	A	T	3: 146,140,521	K529*	probably null	Het
Mdn1	A	C	4: 32,725,854	D2591A	probably damaging	Het
Med12l	A	G	3: 59,252,330	I1267V	probably benign	Het
Mei4	C	A	9: 81,927,542	S226*	probably null	Het
Mios	G	A	6: 8,234,255	V809M	probably benign	Het
Mmp17	G	A	5: 129,595,422	R146Q	possibly damaging	Het
Mob3a	G	A	10: 80,691,384	Q36*	probably null	Het
Naca	A	T	10: 128,048,074	I2125F	probably damaging	Het
Ndst3	A	C	3: 123,528,915	S840A	probably benign	Het
Nlrp4c	T	C	7: 6,065,604	M168T	probably damaging	Het
Nt5c3	A	G	6: 56,897,773		probably null	Het
Olfr1245	C	A	2: 89,575,279	G149V	probably damaging	Het
Olfr1489	T	C	19: 13,634,037	S309P	probably benign	Het
Olfr366	T	A	2: 37,219,944	S152T	probably damaging	Het
Olfr774	T	A	10: 129,238,809	I220N	possibly damaging	Het
Pcgf3	A	G	5: 108,486,197	D107G	probably benign	Het
Pde2a	A	G	7: 101,510,381	D816G	probably damaging	Het
Phf10	T	A	17: 14,955,999	T131S	possibly damaging	Het
Phrf1	A	G	7: 141,232,533	D70G	unknown	Het
Piezo2	A	G	18: 63,093,015	L850S	probably damaging	Het
Plcg1	T	A	2: 160,754,553		probably benign	Het
Plekhh2	A	T	17: 84,574,993	I676L	probably benign	Het
Ppp1r9a	T	G	6: 5,115,196	V804G	probably damaging	Het
Ppt2	T	C	17: 34,625,639	H180R	possibly damaging	Het
Prdm15	T	C	16: 97,816,866	H398R	unknown	Het
Rab26	A	T	17: 24,529,798	M208K	probably damaging	Het
Rab31	A	C	17: 65,667,864		probably benign	Het
Radil	A	G	5: 142,485,449	V1024A	probably damaging	Het
Rorb	A	G	19: 18,983,416	I65T	probably damaging	Het
Sall1	A	T	8: 89,032,855	V207E	probably damaging	Het
Sart3	A	T	5: 113,744,667	M864K	possibly damaging	Het
Sdcbp2	T	A	2: 151,589,537	S277T	probably benign	Het
Sept5	A	G	16: 18,624,872	V100A	probably benign	Het
Sipa1	C	T	19: 5,660,952	R10Q	probably damaging	Het
Ski	A	T	4: 155,160,662	S376T	probably damaging	Het
Slc15a4	A	T	5: 127,596,651	D566E	probably benign	Het
Srgap2	G	A	1: 131,345,806	Q372*	probably null	Het
Stard9	A	G	2: 120,703,578	T3439A	probably damaging	Het
Tln1	T	C	4: 43,534,769		probably benign	Het
Tmco3	A	G	8: 13,295,998	M279V	probably benign	Het
Tmem39b	T	C	4: 129,676,398		probably benign	Het
Trio	T	A	15: 27,732,546	N3083I	probably damaging	Het
Ube3b	G	A	5: 114,393,090	R215Q	probably benign	Het
Ubr1	T	C	2: 120,866,483	N1646S	probably benign	Het
Uqcrc1	T	G	9: 108,947,040	F270C	probably damaging	Het
Vmn2r108	T	A	17: 20,462,425	N839I	probably damaging	Het
Vmn2r75	A	T	7: 86,163,268	S514R	probably damaging	Het
Wdfy4	C	G	14: 32,967,532	V3016L		Het
Wdr11	A	G	7: 129,599,056	N77S	probably benign	Het
Wdr17	C	A	8: 54,640,092		probably benign	Het
Wrn	T	A	8: 33,292,643	N753I	probably damaging	Het
Zan	A	G	5: 137,463,277		probably null	Het
Zfat	T	A	15: 68,084,429	T1203S	possibly damaging	Het
Zfhx2	A	C	14: 55,075,052	S62A	probably benign	Het

Other mutations in Myo3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Myo3a	APN	2	22332473	missense	probably benign	0.42
IGL01307:Myo3a	APN	2	22558289	missense	probably damaging	1.00
IGL01413:Myo3a	APN	2	22297600	missense	probably benign	0.25
IGL01655:Myo3a	APN	2	22423326	missense	probably damaging	1.00
IGL01767:Myo3a	APN	2	22423222	missense	probably damaging	0.96
IGL01803:Myo3a	APN	2	22241115	missense	probably damaging	1.00
IGL01969:Myo3a	APN	2	22297688	missense	probably benign	0.03
IGL02043:Myo3a	APN	2	22399965	missense	probably benign	0.01
IGL02124:Myo3a	APN	2	22577526	missense	probably benign	0.01
IGL02174:Myo3a	APN	2	22332393	missense	probably benign	0.04
IGL02649:Myo3a	APN	2	22323607	missense	probably benign
IGL02976:Myo3a	APN	2	22542452	nonsense	probably null
IGL03328:Myo3a	APN	2	22578198	missense	probably benign	0.02
IGL03376:Myo3a	APN	2	22600074	splice site	probably benign
lose	UTSW	2	22558320	nonsense	probably null
snooze	UTSW	2	22282634	missense	probably damaging	0.99
A5278:Myo3a	UTSW	2	22323653	missense	probably benign	0.27
PIT4445001:Myo3a	UTSW	2	22542415	missense	possibly damaging	0.64
R0008:Myo3a	UTSW	2	22579741	missense	probably damaging	0.99
R0099:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0212:Myo3a	UTSW	2	22291848	missense	probably damaging	1.00
R0281:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0282:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0492:Myo3a	UTSW	2	22323636	missense	possibly damaging	0.46
R0498:Myo3a	UTSW	2	22577429	missense	possibly damaging	0.74
R0594:Myo3a	UTSW	2	22544332	splice site	probably benign
R0609:Myo3a	UTSW	2	22333513	missense	probably benign	0.29
R0609:Myo3a	UTSW	2	22396299	missense	possibly damaging	0.95
R0827:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R0968:Myo3a	UTSW	2	22558289	missense	probably damaging	1.00
R1157:Myo3a	UTSW	2	22542414	critical splice acceptor site	probably null
R1301:Myo3a	UTSW	2	22267095	splice site	probably benign
R1352:Myo3a	UTSW	2	22323675	critical splice donor site	probably null
R1443:Myo3a	UTSW	2	22282626	missense	probably damaging	0.99
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1517:Myo3a	UTSW	2	22282634	missense	probably damaging	0.99
R1565:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1712:Myo3a	UTSW	2	22564992	missense	probably damaging	1.00
R1722:Myo3a	UTSW	2	22399827	missense	probably benign	0.03
R1822:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1823:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1824:Myo3a	UTSW	2	22396243	missense	probably benign
R1837:Myo3a	UTSW	2	22577592	missense	possibly damaging	0.76
R1867:Myo3a	UTSW	2	22399846	missense	probably benign	0.00
R1917:Myo3a	UTSW	2	22291922	missense	probably damaging	1.00
R1920:Myo3a	UTSW	2	22564996	missense	probably benign	0.02
R1937:Myo3a	UTSW	2	22396315	missense	probably damaging	1.00
R1954:Myo3a	UTSW	2	22241226	missense	probably damaging	1.00
R1988:Myo3a	UTSW	2	22578128	missense	possibly damaging	0.86
R2091:Myo3a	UTSW	2	22333677	missense	probably damaging	0.99
R2115:Myo3a	UTSW	2	22245531	missense	probably damaging	1.00
R2125:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2126:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2216:Myo3a	UTSW	2	22577771	missense	probably benign	0.00
R2413:Myo3a	UTSW	2	22577912	missense	probably benign	0.00
R2964:Myo3a	UTSW	2	22340256	missense	possibly damaging	0.90
R3196:Myo3a	UTSW	2	22399868	missense	possibly damaging	0.86
R3837:Myo3a	UTSW	2	22565109	splice site	probably benign
R3905:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R3926:Myo3a	UTSW	2	22565041	missense	probably damaging	0.99
R4014:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4015:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4017:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4043:Myo3a	UTSW	2	22333539	splice site	probably benign
R4044:Myo3a	UTSW	2	22577700	missense	probably damaging	0.99
R4057:Myo3a	UTSW	2	22266160	missense	probably benign	0.01
R4192:Myo3a	UTSW	2	22407377	missense	probably damaging	1.00
R4282:Myo3a	UTSW	2	22340278	missense	probably benign	0.14
R4321:Myo3a	UTSW	2	22267155	missense	probably damaging	1.00
R4393:Myo3a	UTSW	2	22577854	missense	probably damaging	0.99
R4398:Myo3a	UTSW	2	22577842	missense	probably benign
R4446:Myo3a	UTSW	2	22600137	missense	probably damaging	1.00
R4685:Myo3a	UTSW	2	22407422	missense	probably damaging	1.00
R5032:Myo3a	UTSW	2	22282602	missense	probably damaging	1.00
R5096:Myo3a	UTSW	2	22574242	missense	probably benign	0.16
R5183:Myo3a	UTSW	2	22578158	missense	probably benign	0.05
R5458:Myo3a	UTSW	2	22245550	missense	probably damaging	1.00
R5502:Myo3a	UTSW	2	22558369	missense	probably damaging	1.00
R5522:Myo3a	UTSW	2	22574341	missense	probably damaging	1.00
R6462:Myo3a	UTSW	2	22558411	missense	probably damaging	1.00
R6479:Myo3a	UTSW	2	22577865	missense	probably benign	0.00
R6513:Myo3a	UTSW	2	22407332	missense	probably damaging	1.00
R6520:Myo3a	UTSW	2	22399926	missense	possibly damaging	0.90
R6602:Myo3a	UTSW	2	22577787	missense	probably damaging	0.96
R6671:Myo3a	UTSW	2	22294522	missense	probably damaging	1.00
R6743:Myo3a	UTSW	2	22361664	missense	probably benign	0.24
R6865:Myo3a	UTSW	2	22574301	missense	probably benign	0.00
R6961:Myo3a	UTSW	2	22245558	missense	probably benign	0.00
R7001:Myo3a	UTSW	2	22332377	missense	probably benign	0.04
R7215:Myo3a	UTSW	2	22245567	missense	possibly damaging	0.78
R7301:Myo3a	UTSW	2	22544466	critical splice donor site	probably null
R7318:Myo3a	UTSW	2	22558320	nonsense	probably null
R7447:Myo3a	UTSW	2	22544426	missense	probably benign	0.27
R7456:Myo3a	UTSW	2	22407444	missense	probably benign	0.08
R7528:Myo3a	UTSW	2	22266114	nonsense	probably null
R7731:Myo3a	UTSW	2	22282589	missense	probably damaging	1.00
R7768:Myo3a	UTSW	2	22241143	missense	probably damaging	0.99
R8054:Myo3a	UTSW	2	22574317	missense	probably benign	0.00
R8140:Myo3a	UTSW	2	22407346	missense	probably damaging	1.00
R8143:Myo3a	UTSW	2	22282665	critical splice donor site	probably null
R8346:Myo3a	UTSW	2	22558422	critical splice donor site	probably null
R8421:Myo3a	UTSW	2	22362124	missense	probably benign	0.07
R8495:Myo3a	UTSW	2	22396273	missense	probably damaging	0.96
R8551:Myo3a	UTSW	2	22332466	missense	probably benign	0.00
R8757:Myo3a	UTSW	2	22558307	missense	possibly damaging	0.49
R8759:Myo3a	UTSW	2	22558307	missense	possibly damaging	0.49
R8779:Myo3a	UTSW	2	22245593	nonsense	probably null
R8828:Myo3a	UTSW	2	22241053	missense	probably benign	0.01
R8910:Myo3a	UTSW	2	22574268	missense	probably benign	0.01
R8916:Myo3a	UTSW	2	22567692	missense	probably damaging	1.00
R8926:Myo3a	UTSW	2	22396263	missense	possibly damaging	0.95
R9028:Myo3a	UTSW	2	22600087	missense	possibly damaging	0.79
R9046:Myo3a	UTSW	2	22558355	missense	probably damaging	0.99
R9120:Myo3a	UTSW	2	22544426	missense	probably benign	0.27
R9153:Myo3a	UTSW	2	22399933	missense	probably benign	0.02
R9191:Myo3a	UTSW	2	22579829	missense	probably benign	0.24
R9258:Myo3a	UTSW	2	22577533	missense	possibly damaging	0.60
R9436:Myo3a	UTSW	2	22407424	nonsense	probably null
R9464:Myo3a	UTSW	2	22227572	start gained	probably benign
R9487:Myo3a	UTSW	2	22241051	missense	probably benign
R9719:Myo3a	UTSW	2	22544455	missense	probably benign	0.02
R9799:Myo3a	UTSW	2	22600169	missense	probably damaging	1.00
Z1177:Myo3a	UTSW	2	22618140	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- GATCCCATTCCAAGTAGGGC -3'
(R):5'- CTGATCTTGGTTGCCTGACC -3'

Sequencing Primer
(F):5'- CCCTCTTCGCAATATAGTTTCTAAAC -3'
(R):5'- CCTGACCTTGGTATTTTGAAGAG -3'

Posted On

2021-09-22