Incidental Mutation 'R8744:Polr3b'
ID 682562
Institutional Source Beutler Lab
Gene Symbol Polr3b
Ensembl Gene ENSMUSG00000034453
Gene Name polymerase (RNA) III (DNA directed) polypeptide B
Synonyms RPC2, A330032P03Rik, 2700078H01Rik
Accession Numbers

Genbank: NM_027423

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8744 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 84622292-84727178 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) C to A at 84628624 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000076418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077175]
AlphaFold P59470
Predicted Effect probably benign
Transcript: ENSMUST00000077175
SMART Domains Protein: ENSMUSP00000076418
Gene: ENSMUSG00000034453

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 38 413 2e-55 PFAM
Pfam:RNA_pol_Rpb2_2 185 363 8.4e-29 PFAM
Pfam:RNA_pol_Rpb2_3 438 502 2.6e-22 PFAM
Pfam:RNA_pol_Rpb2_4 539 600 1e-29 PFAM
Pfam:RNA_pol_Rpb2_5 621 661 6.5e-14 PFAM
Pfam:RNA_pol_Rpb2_6 668 1041 5.8e-129 PFAM
Pfam:RNA_pol_Rpb2_7 1043 1129 7.6e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the second largest subunit of RNA polymerase III, the polymerase responsible for synthesizing transfer and small ribosomal RNAs in eukaryotes. The largest subunit and the encoded protein form the catalytic center of RNA polymerase III. Mutations in this gene are a cause of hypomyelinating leukodystrophy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(48) : Targeted, other(2) Gene trapped(46)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik C A 11: 58,291,434 probably null Het
Adam2 A G 14: 66,034,716 probably null Het
Akt2 A T 7: 27,618,313 D94V probably benign Het
Anapc7 C T 5: 122,428,148 S40L probably benign Het
Ash1l G T 3: 89,058,583 A2431S possibly damaging Het
Atoh1 A T 6: 64,729,918 Q199L probably damaging Het
Atp10b T C 11: 43,230,350 C947R probably damaging Het
Ccdc50 G A 16: 27,436,398 V199I possibly damaging Het
Ccne1 A T 7: 38,103,173 C65S probably benign Het
Cep152 A G 2: 125,594,871 probably null Het
Col6a3 C G 1: 90,767,606 probably benign Het
Cyp4a10 A G 4: 115,529,470 D438G probably benign Het
Dgkb A G 12: 38,438,612 H659R probably damaging Het
Dhx29 A G 13: 112,952,884 I730V possibly damaging Het
Dync2h1 G A 9: 7,011,220 Q3658* probably null Het
Eif2ak4 C A 2: 118,430,993 C671* probably null Het
Eif4g3 AGCGGCGGCGGCGGCGGC AGCGGCGGCGGCGGC 4: 137,994,061 probably benign Het
Ep400 T C 5: 110,742,059 H446R unknown Het
Epb41l2 C T 10: 25,441,827 L81F probably damaging Het
Ercc8 G A 13: 108,183,773 A298T probably benign Het
Fbxo10 T C 4: 45,043,880 M648V probably benign Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gnpda2 C T 5: 69,578,116 A211T probably damaging Het
Gtf2h5 C CA 17: 6,084,558 probably null Het
Hormad1 T C 3: 95,562,615 Y58H possibly damaging Het
Igkv4-81 T C 6: 68,991,062 I18M possibly damaging Het
Itgav G T 2: 83,770,083 A312S probably benign Het
Itpr1 G T 6: 108,377,802 A457S possibly damaging Het
Kcna10 T C 3: 107,194,386 L111P probably damaging Het
Kcnh7 T C 2: 63,182,089 R92G possibly damaging Het
Lamc2 G A 1: 153,143,738 P486S probably benign Het
Lrba C T 3: 86,304,333 T420M probably benign Het
Lrrc52 G A 1: 167,466,581 T45M probably benign Het
Lsm8 C A 6: 18,853,639 A80E probably benign Het
Ly6g T A 15: 75,155,669 S9T probably benign Het
Mcc A G 18: 44,724,572 Y159H probably benign Het
Megf11 T C 9: 64,544,688 probably null Het
Mrpl9 T A 3: 94,447,775 probably benign Het
Ndst4 T C 3: 125,713,340 F210L possibly damaging Het
Olfr1168 T A 2: 88,185,379 C167* probably null Het
Olfr1402 A G 3: 97,410,281 V300A probably benign Het
Pappa2 A G 1: 158,783,917 V1492A possibly damaging Het
Pcdhga2 A G 18: 37,671,320 H739R probably benign Het
Pcdhga8 A G 18: 37,727,774 T628A probably damaging Het
Plekhn1 C T 4: 156,233,907 R86H probably damaging Het
Pofut1 T A 2: 153,259,541 W72R probably benign Het
Rab3b A T 4: 108,923,987 I104F probably damaging Het
Rab5b A T 10: 128,682,882 V127D probably damaging Het
Rnf170 A G 8: 26,129,380 M211V unknown Het
Rpl7 T C 1: 16,101,889 T218A probably benign Het
Serinc2 T C 4: 130,265,195 probably benign Het
Socs2 T A 10: 95,392,800 Q196L Het
Stab2 T C 10: 86,969,349 H255R probably benign Het
Syvn1 G A 19: 6,049,168 G149D probably damaging Het
Them5 T C 3: 94,346,165 S161P probably damaging Het
Tlr1 A T 5: 64,926,530 Y235N possibly damaging Het
Toporsl T C 4: 52,611,967 L620P probably benign Het
Traf3 A T 12: 111,261,796 E480D probably benign Het
Trav13n-4 A G 14: 53,363,942 Y56C probably damaging Het
Trps1 T C 15: 50,661,246 Y1096C probably damaging Het
Usp2 A G 9: 44,087,213 probably benign Het
Usp40 A T 1: 87,983,769 L512Q probably benign Het
Vmn1r175 T C 7: 23,808,978 T75A probably benign Het
Zan A G 5: 137,427,864 V2550A unknown Het
Zfp235 A T 7: 24,140,499 E114D possibly damaging Het
Zmym1 A T 4: 127,051,372 D141E probably damaging Het
Other mutations in Polr3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Polr3b APN 10 84676990 missense probably benign
IGL00848:Polr3b APN 10 84680377 missense probably damaging 1.00
IGL00901:Polr3b APN 10 84631796 missense possibly damaging 0.94
IGL01313:Polr3b APN 10 84725743 missense probably damaging 1.00
IGL01364:Polr3b APN 10 84695669 missense probably benign 0.00
IGL01731:Polr3b APN 10 84631840 nonsense probably null
IGL03326:Polr3b APN 10 84667395 missense probably benign 0.43
IGL03369:Polr3b APN 10 84676952 missense probably damaging 1.00
etruscan UTSW 10 84632538 missense probably benign 0.00
pennyweight UTSW 10 84713632 missense probably damaging 1.00
pinhead UTSW 10 84655991 missense probably damaging 1.00
G5538:Polr3b UTSW 10 84631794 missense probably benign 0.21
PIT4382001:Polr3b UTSW 10 84684185 missense probably damaging 1.00
R0180:Polr3b UTSW 10 84622515 missense probably benign
R0270:Polr3b UTSW 10 84718475 missense probably benign 0.02
R0541:Polr3b UTSW 10 84638064 missense probably damaging 1.00
R0890:Polr3b UTSW 10 84714336 missense probably benign 0.01
R1302:Polr3b UTSW 10 84632486 missense probably damaging 0.97
R1511:Polr3b UTSW 10 84680385 missense probably benign
R1561:Polr3b UTSW 10 84634912 missense probably damaging 1.00
R1607:Polr3b UTSW 10 84652783 missense probably benign 0.00
R1624:Polr3b UTSW 10 84679805 missense probably damaging 0.98
R1809:Polr3b UTSW 10 84693001 missense probably damaging 1.00
R1830:Polr3b UTSW 10 84692922 nonsense probably null
R2973:Polr3b UTSW 10 84628280 missense probably benign 0.00
R3401:Polr3b UTSW 10 84699491 missense probably damaging 0.96
R3876:Polr3b UTSW 10 84720518 critical splice donor site probably null
R3961:Polr3b UTSW 10 84684302 missense possibly damaging 0.89
R4664:Polr3b UTSW 10 84714369 missense probably damaging 1.00
R4721:Polr3b UTSW 10 84656003 missense possibly damaging 0.56
R4972:Polr3b UTSW 10 84638124 missense probably damaging 1.00
R5065:Polr3b UTSW 10 84632538 missense probably benign 0.00
R5264:Polr3b UTSW 10 84667416 missense probably benign 0.02
R5302:Polr3b UTSW 10 84699400 missense possibly damaging 0.59
R5795:Polr3b UTSW 10 84628252 missense probably benign
R5795:Polr3b UTSW 10 84677011 missense probably damaging 0.97
R5838:Polr3b UTSW 10 84674590 missense probably benign 0.09
R6419:Polr3b UTSW 10 84638111 missense possibly damaging 0.78
R6568:Polr3b UTSW 10 84634903 missense probably damaging 1.00
R6787:Polr3b UTSW 10 84628625 critical splice acceptor site probably null
R6913:Polr3b UTSW 10 84713632 missense probably damaging 1.00
R7405:Polr3b UTSW 10 84684179 missense probably benign
R7456:Polr3b UTSW 10 84622491 missense probably benign
R7657:Polr3b UTSW 10 84655991 missense probably damaging 1.00
R8074:Polr3b UTSW 10 84713659 missense probably damaging 1.00
R8082:Polr3b UTSW 10 84656063 missense probably damaging 1.00
R8127:Polr3b UTSW 10 84679789 missense probably benign
R8676:Polr3b UTSW 10 84680387 missense probably benign 0.00
R8797:Polr3b UTSW 10 84697015 nonsense probably null
R8866:Polr3b UTSW 10 84695691 missense probably benign 0.14
R9006:Polr3b UTSW 10 84631833 missense probably benign 0.05
R9397:Polr3b UTSW 10 84631789 missense possibly damaging 0.93
X0066:Polr3b UTSW 10 84713695 missense probably damaging 0.97
Z1177:Polr3b UTSW 10 84714293 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGAGAAACACTAATGGTTACCTGC -3'
(R):5'- ACTAGACAGATACAGTAGTGGTATTAC -3'

Sequencing Primer
(F):5'- TAATGGTTACCTGCCCCAGAGTG -3'
(R):5'- GTGGTATTACAAGAGATTTGACAGC -3'
Posted On 2021-09-30